(EAW intro plays.)

(PREVIOUSLY ON SHOWDOWN…)

(RECAP: We witnessed the ending of the saga of Harlow Reichert trying to get her Answers World Championship Match when Mr. DEDEDE joins Showdown via satelite to deny Harlow a chance at the title. Instead, Mr. DEDEDE makes the announcement that he will be on Showdown next week and will defend the title…in an Extreme Elimination Chamber Match against some of the brutal and most dangerous individuals in wrestling and the planet.)

(TRANSITION: It goes to a pissed off Harlow Reichert who is packing her belongings before Jenny Punk is able to catch up to her. Harlow brings up her wanting to get off Showdown and getting a title shot on any brand, regardless of the champion. Jenny suggest Harlow taking part of the Extreme Elimination Chamber, but Harlow denies the idea. Then, Jenny brings up Harlow facing Jake for the PURE Championship. Harlow is hesitant, but eventually agrees to the match.)

(TRANSITION: We go to the brewing rivalry between Shane Gates who takes part of commentary and Lance Blackflyre who takes on PURE Champion Jake Smith. Highlights of the match is seen, but as Lance seems to be getting the upper hand, but Shane gets on top of the apron to provide a distraction. As the referee is focused on Shane, Jake manages to low blow Lance and connects with a few knee strikes in order to win the match.)

(TRANSITION: Kensingten Calhoun-Astor takes on a debuting Candice Blair. Highlights of the match are seen. The two women are making an impression to remember. The match ends with Kensingten applying Something to Cry About on Candice. After a moment of contemplating, Candice submits to the submission move, giving Kensingten a well-needed victory going into Road to Redemption.)

(TRANSITION: It goes to the main event where Minerva takes on Chris Elite. Highlights of the match is shown. Towards the end of the match, Minerva connects with Paradise Lost, but before the three count, Ahren Fournier pulls the referee out of the ring and throws him to the barricade. Ahren gets into the ring and tries to connect with Storybook Ending and Minerva manages to move out of the way, but ends up eating a superkick by Ahren. Constance tries to get the referee up, but he’s still down. Ahren and Chris get Minerva up and look to connect with Put it on Ice, but Constance his Ahren with a cutter. Constance rolls Ahren out of the ring with her and lets Minerva and Chris resume their match. Chris tries to connect with Long Kiss Goodnight, but Minerva manages to kick Chris between the legs and connect with The Princess Killer and get a victory over the former World Champion. The recap ends with Heavenly Hell standing tall and Ahren getting Chris and Jennipurr and making their way up the ramp.)

(The recap ends before fading into the Candian Tire Center. The crowd is explosive and holding up their signs high and proud.)

(SCREEN BAR — OTTAWA, ONTARIO, CANADA!)

(“Money and the Power” by Kid Ink plays through the speakers of the Canadian Tire Centre! The fans began to boo, familiar with the entrance music of one of the hottest tag teams in EAW at the moment. The ILLIONAIRES — Chris Elite and Ahren Fournier, along with Jennipurr, stroll from the back. It seems like Jennipurr’s feelings are hurt due to negative reception from the EAW Universe, but Ahren assures her that it’s opposite day and they really love her.)

Gavin Kirkland: THE ILLIONAIRES MAKE THEIR PRESENCE KNOWN ON SHOWDOWN! WE ARE BEGINNING OFF THIS GO HOME SHOW IN THE BEST WAY POSSIBLE!!!

Eve: EAW Universe, Welcome to Saturday Night Showdown! Can you believe it? We’re a week away from the last of the big five FPVs of 2019. Tonight, we present you the last Showdown of 2019 and like Gavin said, we’re starting off things by with The ILLIONAIRES.

Deadprez: Heavenly Hell finally get their hands on The ILLIONAIRES. People can argue that Chris Elite and Ahren Fournier didn’t deserve this opportunity for the Unified Tag Team Championships, but you can’t out rule a Gawd Contract, which is the reason why this match is possible in the first place!

Gina Romano: LADIES AND GENTLEMEN…PLEASE WELCOME AT THIS TIME… THE ILLLLLLIIIIOOOOOONNNNNNNNAAAAAAAIIIIIIRRRRRREEEEESSSSSSSSSSSS!!!!!!

Gavin Kirkland: Last week on Showdown, Chris Elite fell short in defeating Minerva. Are people that surprised that Minerva pulled all of the stops to defeat Chris?

Eve: Minerva did what she needed to do to win the match. She took advantage of the chaotic scene that erupted during the closing part of the match. It was a huge victory for Minerva and it let The ILLIONAIRES be aware that Heavenly Hell isn’t playing any games heading towards Road to Redemption.

(“Money and the Power” dies down. The camera goes to Chris Elite and Ahren Fournier inside the squared circle. Both with microphones in their hands. Meanwhile, Jennipurr sits on the left side of Ahren with a microphone in front of her. The crowd continues to boo The ILLIONAIRES as they all smile and grin, not feeling phased of the negative reception at all.)

Chris Elite: ight, we got some dickeaters here.

Ahren Fournier: Hmm.. I could care less what people in Calgary, Alberta, Canada have to say!

(The crowd boos intensifies. Not only did Ahren Fournier make a comment of one of their cities, but he called them by the wrong city.)

Chris Elite: We’re in Ottawa, bozo.

Ahren Fournier: Same difference. Both of them cities trash. What makes Canada believes that they are worthy of getting the hottest tag team in EAW? Why does Road to Redemption need to be in Toronto in all places? It was so cold today that Jennipurr was shivering. I needed to double layer the poor thing before we stepped foot inside the arena. How does anyone stand this weather?

Chris Elite: This weather is suited for those vampire bitches that we’re facing next weekend. How in the fuck are we supposed to be intimidated of two Twilight rejects that need to get their asses back to Forks, Washington because there is no way that they belong in the ring with the likes of us. At Pavement to Restitution (hi Xander), we are going to expose these bitches for how they are. Two women that can’t hack it when going up against two of the best Elitists on Showdown and EAW as a whole. Two women that can’t rely on each other. At least with me and Ahren, we can rely on each other. Two weeks ago was the biggest example I can think of at the moment. I didn’t need to insert myself in Ahren’s search for Jennipurr, but I went out there and found Jennipurr. I went out there and caused those bitches a shot to insert themselves in the Extreme Elimination Chamber. Why is that, Ahren?

Ahren Fournier: Hmmm…I don’t know. Tell me, Chris.

Chris Elite: That’s because there’s nothing I wouldn’t do for you, Ahren. There’s nothing that we wouldn’t do for each other. Constance or whoever the fuck her name is couldn’t do the same thing at Wicked Games Instead, she had to watch her partner get smoked by Ahren and I. At that moment, a single’s championship was more important to her than her tag team partner. Ahren and I could never.

Ahren Fournier: People are always looking to write us off as two giant egos who can’t coexist as a team. There was no one in that locker room who believed that he we would last this long as a tag team, but look at us, Chris. We’ve defeated every tag team that has been thrown our way. We defeated Jamie and Cameron at Reasonable Doubt. That should have been enough to justify our claim for the Tag Team Championships. But, it was so fun to use that Gawd Contract. Just the ability to book shit is so much fun. How about we use that contract one last time before Road to Redemption?

(The crowd’s interest peaks at the sound of that question.)

Chris Elite: :oh: That sounds like a GOAT idea, Ahren. Honestly, I have been thinking of shit in order to use this contract for, but there is so much that we can do going into this match. I love messing with those two bitches. Getting them pissed off is something that I like to laugh at. Those bitches have nothing, but those Tag Team Championships. The moment that we take those titles away, I wouldn’t be shocked if they leave the company because god forbid any of those bitches from losing a match against amazing talent such as ourselves.

Ahren Fournier: Heavenly Hell don’t got shit on us. They trash —

(“No More” by Disturbed blasts through the speakers as the crowd gives the Unified Tag Team Champions. At the same time, it cuts Ahren Fournier off mid sentence as The ILLIONAIRES look at the entrance ramp in search of Heavenly Hell. Moments later, Heavenly Hell come out in their ring attire, they have a match later tonight, but they have had enough with what The ILLIONAIRES had to say about them. Constance Blevins and Minerva have microphones in their possession.)

Eve: It seems like Heavenly Hell had enough with The ILLIONAIRES running their mouth. I don’t think pissing off Constance or Minerva is going to work well in their favor.

Deadprez: These two are not in the mood for this degrading from The ILLIONAIRES.

Gavin Kirkland: Well, Chris did call them vampire bitches, but that may not compare to the shit that Chris and Ahren have said within the past few minutes.

(“No More” dies down.)

Minerva: Are you done? On second thought, I could care less if you were finished talking or not. I’m here to change the tone of this discussion. Constance and I could care less about these little mind games from the two of you. I’m not too crazy about these childish things with insulting our looks, which we’ve claimed was going to happen the moment that we crossed paths. You two could have come up with some a bit more original, but that would be expecting too much from the two of you. It’s such a shame that you needed to cross these lines and bring some of these topics into the light. You talk about how Constance and myself can’t rely on each other for anything. You bring up Wicked Games as the biggest example on this subject, but perhaps, you don’t share the bond that Constance and I have. The two of you talk about how you could do ANYTHING for each other, but would you take a bullet for your partner? Would you put yourself in harm’s way if it meant that your partner could accomplish the one thing that’s most important to him? I know the answer to that already: no. You may have surprised people by staying as a tandem for as long as you have, but like I said — you don’t have the bond that Constance and I have. Insult us, call us demeaning names, make fun of our appearances, but we didn’t come to EAW to be molded into their ideal Elitist. We’re happy with who we are and what we look like. We’re happy as Heavenly Hell. I can’t imagine my life without Constance. I never expected for Constance to come into my life. I never expected to be holding the Unified Tag Team Championships and I never expected to embark in a six month reign as champions.

Constance Blevins: EAW did it’s job with trying to keep us down in favor of the golden girls and via association with Jenny Punk, The ILLIONAIRES are no different from those golden girls at all. You two are being propped as the ones who COULD take the titles away from us, but Minerva and I refuse to go down without a fight. Minerva and I refuse to fall and let the prestige of these championships go down the drain the moment you get your greasy hands on these titles. I’m aware that the mannerisms of Chris Elite has been something that newcomers have used as an example and that makes me absolutely sick. Minerva and I should be the woman that these newer Elitists should use as an example. We’re both women who don’t fit a certain criteria. We’re women who never backed down despite the system trying to find any opportunity to make us fail and with that Gawd Contract, there’s talk that this stupid contract is going to be the downfall of our reign as champions? Chris, look into my eyes. Don’t worry, Minerva isn’t going to be crafting up any spells, but look me in the eyes because what I am going to say next is important. We don’t care about your contract. It doesn’t intimidate us whatsoever. At the most, it has become a pain because it’s the reason why Minerva and I aren’t going to reach that “Elite status” and clash with some of the best in this company.

Minerva: You’re right, Constance. That Gawd Contract should be burned because it’s the reason why we’re not stepping into that Extreme Elimination Chamber. Everyone knows that if we stepped foot inside that structure, we would be a force to be reckoned with in the match. We would be the ones to change the tide of the match. Ignoring the result of that qualifying match for a moment, let’s establish something. Jamie O’Hara and Cameron Ella Ava needed that Gawd Contract. It shouldn’t be denied that we DOMINATED them. We made them OUR bitch. The so-called “Golden Couple” was wondering what in the hell they needed to do to put us down. Constance would have been the first person this season to pin Jamie’s shoulder to the mat and it would be something that they couldn’t take away from us. Constance said it clearly — we don’t care about your contract. Throw anything at us and we’ll throw it back to you a million times harder.

Ahren Fournier: Is that so? You can take whatever The ILLIONAIRES throw at you?

(Constance Blevins and Minerva nod their heads in confidence.)

Chris Elite: Well, you heard them, Ahren; they can handle ANYTHING that we throw at them. It’s tempted me even more use this Gawd Contract one last time before Pavement to Restitution.

Minerva: Use the damn contract. I’m not in the mood for these games this week.

Chris Elite: Okay, how about we raise the stakes of this title match? You two are fighters and Constance, it seems like you were having fun with bashing that steel chair on Ahren’s back a few weeks ago. I mean, you even brought a table into the equation and almost put Ahren through it. But, do you know what this match needs?

Ahren Fournier: More cowbell.

Chris Elite: :skip: No, guess again.

Ahren Fournier: Ladders.

Chris Elite: Bingo. Via the power of the Gawd Contract — not sure if that’s necessary to say — but, at Road to Redemption, Heavenly Hell will be defending those Unified Tag Team Championships against The ILLIONAIRES in a … TABLES, LADDERS AND CHAIRS MATCH!!!

(The crowd explodes in that added stipulation to the Unified Tag Team Championship Match. Heavenly Hell look at each other with sinister smirks on their face before looking at their opponents at Road to Redemption.)

Minerva: We like the pretty weapons to play with. Anything that I can get my hands on to bash your brains out is going to make me happy.

Constance Blevins: How about we start now, Minnie?

Chris Elite and Ahren Fournier: :krabs: !!!!!

(Heavenly Hell drops their microphones as they go racing down the entrance ramp. Ahren Fournier picks up Jennipurr and puts her away from all the action. The ILLIONAIRES are waiting in the ring for the collision that’s going to happen.)

Deadprez: ARE WE REALLY GOING TO SEE A PREVIEW THE ILLIONAIRES VERSUS HEAVENLY HELL???

???: Stay away from that ring, Heavenly Hell!

(The crowd begins to boo as the presence of Showdown General Manager. Jenny Punk appears from the back and stands on top of the entrance ramp. Heavenly Hell was inches away from the ring, but turn around to look at Jenny, feeling very irritated at the moment.)

Jenny Punk: There’s no denying that The ILLIONARIES versus Heavenly Hell is money. It’s one of the most talked about matches outside of the chamber matches. I’m not planning to mess up this match by having the four of you clash a week before Road to Redemption. You two are going to meet each other later tonight. I’ll allow the four of you to clash there, but as of right now, I’m not allowing any collisions. Constance, Minerva, you’re not the only one in the mood for any of these games and I’m the same way. I think it’s best if you to head to the back until your match. Think about your actions and whether pissing off The ILLIONAIRES is something you want to be doing.

(Constance Blevins and Minerva look at The ILLIONAIRES at the ring, who don’t seem to be on the defensive side anymore. It’s probably because they believe that Jenny Punk’s warning will be enough to make them back down from this collision. Then, they look at Jenny Punk, who’s expecting for Heavenly Hell to just wait for later tonight to get their hands on The ILLIONAIRES. Minerva puts on a fake smile, trying not to slap the heads off of anyone at the moment.)

Minerva (off-mic to Jenny Punk): I agree, I think it’s best for us to head to the back until your match (looks at Constance Blevins). Right, Constance?

(Constance Blevins puts on a fake smile, similar to one that Minerva dawns on her face at the moment.)

Constance Blevins (off-mic): I agree. It gives us a lot of time to sit down and think.

(With that, Heavenly Hell make their way up the ramp. Before heading straight to the back, the Unified Tag Team Champions exchange a fake smile at Jenny Punk, almost making the General Manager uncomfortable. The ILLIONAIRES stand in the ring with Jenny feeling relieved that Heavenly Hell didn’t proceed to attack the woman.)

Gavin Kirkland: I don’t think that giving Heavenly Hell time to think about these things is going to work well in their favor? :lupe:

Eve: This is starting off to be a great Showdown! We have four matches in order to determine who will take part of the King of Elite Tournament; we have a giant eight person tag team match as The ILLIONAIRES team up with Xander Payne and Mark Michaels to take on Heavenly Hell, Jamie O’Hara and Cameron Ella Ava!

Deadprez: One of the most anticipated matches of the entire week will be that the Chairman of the Board, Mr. DEDEDE will be defending the Answers World Championship against some of the most brutal and dangerous individuals, not only in wrestling history, but the PLANET!

Eve: A lot to look forward to tonight! We’re going to commercial break, but we’ll be right back with more Showdown! Stay tuned!

(A new commercial for Road to Redemption as Heavenly Hell will be defending the Unified Tag Team Champions against The ILLIONAIRES in a Tables, Ladders and Chairs Match live on the EAW Network next weekend!)

(“Love it Loud” by Kiss kicks off as the crowd cheers, the howling of a wolf sounds throughout the arena before Shaker Jones walks out, priming his mustache and beard. Focused on the ring, he makes his way, interacting with some fans never keeping his eyes off Gates and Wilson.)

Gina Romano: The Following Contest is the Opening Match for Showdown and it is a King of Elite Tournament Match scheduled for ONE FALL!

Crowd: ONE FALL!!!

Gina Romano: Introducing first, hailing from Inglis, Manitoba! Weighing in at 238 pounds! He is “THE CANADIAN WOLF” SHAKER JONES!

(The crowd cheers as Shaker gets to the ring, he rolls in and stand in the middle, looking over at the crowd and pointing at them as they cheer. He nods as the crowd roars.)

Deadprez: Big opportunity for Shaker Jones, a lot on the line here and against a monster.

Gavin Kirkland: Not just any monster, Lance Blackfyre and I can tell you right now, things are going to get very interesting on this Showdown, this is the first of four qualifiers.

Eve: It is and Shaker Jones would want nothing more than to be in the tourney but that is a tall task to ask of, he is facing Blackfyre.

(As Shaker’s music dies down, “Old Town Road” (Remix) by Lil Nas X ft. Billy Ray Cyrus plays. Lance Blackfyre steps out onto the stage, nodding his head and psyching himself up while most of the audience gives him heat. Some of the audience members appear to be utterly astonished by his size, gawking at Blackfyre and not knowing how to process his gargantuan physique as he approaches the ring. )

Gina Romano: And his opponent! Hailing from Chicago, Illinois, weighing in at 365 pounds…. LANCE BLACKFYRE!!!!!

(He steps over the top rope and heads to the corner, keeping his eye on his opponent, Shaker Jones who backs up some and stares him down.)

Gavin Kirkland: He is not here to play tonight.

Eve: No, he’s not, after suffering some setbacks he promised that this will be a massacre on TV, Lance wants in the tourney and he could do some damage there.

(The referee checks on both Lance and Shaker, he looks at the timekeeper and asks for the bell.)

(DING!!! DING!!! DING!!!)

(Shaker sizes up Lance as he starts to circle the ring, they lock up….)

Deadprez: Blackfyre using his power early pushing Shaker to the mats, but he ain’t staying down, getting back up and going after the monster again, locking up and Blackfyre picks him up, throwing him into the turnbuckle! He goes for a strike, but Shaker moves out of the way, he starts unloading on Blackfyre, lefts and rights, backing up and hitting a running forearm! He has the big man reeling here!

Eve: The only way that Shaker will have success on Blackfyre is by staying on him constantly and consistently! Constance Blevins showed that technique works but if he gives any room to Blackfyre he can tear shaker in half!

Gavin Kirkland: He’s in his home country. I doubt Shaker wants to lose here tonight, look at Blackfyre though, taking Shaker’s forearms over and over! Lance pushes Shaker to the mat, he gets right back up and dropkick! Lance slams against the corner! Shaker charges in with a shoulder black!

(The crowd roars!)

Deadprez: Shaker climbing the ropes and he is laying it into the big man! The crowd is counting the punches!

(Crowd: 1! 2! 3! 4! 5! 6! 7! 8! 9! 10!)

Eve: Shaker is really driving this home and staying on his but NO! Right at the count of Ten, Blackfyre throws him off! Shaker is not giving up, pugnacious as he is, charging in again and a BIG BOOT BY BLACKFYRE! That stuns Shaker and THE MONSTER RUNS OUT OF THE CORNER WITH A HUGE CLOTHESLINE TURNING SHAKER UPSIDE DOWN! BLACKFYRE HAS TURNED THIS MATCH AROUND ALREADY!

Gavin Kirkland: THE POWER OF THIS MAN! HE’S NOT DONE! With what is at stake, both of these men are bringing their A-Game, the winner is in the King of Elite Tournament! The loser is out!

Deadprez: Lance is picking up Shaker, SCOOPING HIM UP FOR A DEVASTATING SLAM! HE PICKS UP SHAKER AGAIN AND ANOTHER THUNDEROUS BODYSLAM! HE IS GOING TO THROW THIS MAN THROUGH THE MAT PLAYA!

Eve: SHAKER IS BEING MANHANDLED RIGHT NOW BY THIS MONSTER! LANCE IS PICKING HIM BACK UP, A THIRD BODYSLAM AND NOW HE IS DROPPING AN ELBOW! PINNING HIM! THIS COULD BE OVER!

ONE!!!!!

TWO!!!!!!!!

THREE…..

Deadprez: SHAKER KICKS OUT! I DON’T THINK EVEN LANCE BLACKFYRE CAN BELIEVE IT! HE PICKS UP SHAKER AGAIN RIGHT INTYO A MASSIVE BEARHUG!

Gavin Kirkland: HE IS GOING TO SQUEEZE THE SHIT OUT OF HIM…. LIKE LITERALLY! WE ARE ABOUT TO HAVE A MESS HERE!

Eve: This is a hold that can absolutely take the life out of you but worse than that a man this strong can make a move like these one hundred times worse!

(The crowd starts to clap in encouragement for Shaker. He slowly fades as the referee checks his arm and starts to lift it….)

Deadprez: I THINK THAT SHAKER IS OUT! HE MIGHT BE DONE! THE REFEREE LIFTS HIS ARM AND IT DROPS! HE LIFTS IT AGAIN….. AND IT DROPS FOR A SECOND TIME! HE LIFTS IT AGAIN AND IT DR…. NO! SHAKER JONES IS STILL IN THIS! EH IS SHAKING LIKE A SHAKER!

Eve: THAT WAS TERRIBLE BUT SHAKER JUST RUNG THE EARS OF BLACKFYRE! HE RUN THEM AGAIN! BLACKFYRE IS NOT LETTING GO! HE SLAPPED THEM AGAIN! THIS TIME LANCE LET’S GO! SHAKER HOLDS HIS BACK IN PAIN, HERE COMES BLACKFYRE AGAIN BUT SHAKER KICKS HIM IN THE GUT! HE KICKS HIM AGAIN! SHAKER RUNS AGAINST THE ROPES AND HITS A CLOTHESLINE BUT BLACKFYRE DOESN’T FALL, HE STAGGERS!

Gavin Kirkland: HERE COMES SHAKER AGAIN WITH ANOTHER HUGE CLOTHESLING AND HE STAGGERS STILL! HE IS NOT GOING TO KNOCK THIS MAN DOWN! ONE MORE TIME! CANADIAN CLOTHESLINE AND BLACKFYRE GOES DOWN! SHAKER CLOTHESLINED HIM OUT OF HIS BOOTS, HOLY SHIT!

(The crowd erupts in a roar and cheer! Shaker looks out, he is getting the energy of the crowd….)

Deadprez: THE ROOF HAS COME OFF THIS BUILDING! LANCE IS GETTING UP AND HERE COEMS SHAKER WITH THE SUPA DUPA KICK! HE LANDED IT FLUSH ON HIS CHEST BUT BLACKFYRE IS STILL ON HIS FEET! SHAKER GOES FOR THE 87’! NO, BLACKFYRE PUSHES HIM OFF AND GOES FOR THE SHATTERED JOY! SHAKER DUCKS AND TURNS HITTING THE 87’!!!!!

Eve: WE ARE ABOUT TO SEE AN UPSET! SHAKER JUMPS ON BLACKFYRE, TURNING HIM OVER FOR THE COVER!

ONE!!!

TWO!!!!

THREE!!!!

………

………

……….

Deadprez: WHAT THE HELL! BLACKFYRE GOT THE SHOUDLER UP AT THE LAST SECOND! SHAKER CAN’T BELIEVE IT! HE HAS HIM! HE LOOKS AT THE REF IN SHOCK! WHAT DOES HE HAVE TO DO TO BEAT THIS MAN!

Gavin Kirkland: THE REF CONFIRMING IT WAS A TWO COUNT! WHAT IS SHAKER DOING!?

Eve: IS HE? HE IS GOING FOR THE SHAKER MAKER!? HE IS TRYING TO LIFT BLACKFYRE UP IN THE FIREMAN’S CARRY! HE IS TRYING TO LIFT UP THE MONSTER…. HE HAS HIM UP!!!!

Gavin Kirkland: ARE YOU KIDDING ME!?

Deadprez: HE IS… NO! LANCE BLACKFYRE JUST RAKED HIS EYES! SHAKER LET’S GO AND TURNS RIGHT INTO THE SHATTERED JOY! STICK A FORK IN SHAKER THIS ONE IS OVER! LANCE MAKES THE COVER!

ONE!!!!!

TWO!!!!!

THREE!!!!!

…….

…….

……..

Eve: SHAKER SLIPS OUT RIGHT BEFORE THE THREE COUNT AND NOW LANCE IS SHOCKED! HE CAN’T BELIEVE THIS DID NOT FINISH SHAKER! THAT IS HOW BAD THESE TWO MEN WANT TO BE IN THE TOURNAMENT!

Gavin Kirkland: I think Blackfyre is going to finish it right here! He picks up Shaker, in the powerbomb position… FEARS ORIGIN! NO! SHAKER SOMEHOW HAS THE POWER TO BACK BODY DROP THE BIG MAN!

Deadprez: WOW!

(The crowd goes nuts, erupting in cheers….)

Eve: SHAKER MIGHT PULL THIS OFF! LANCE IS GETTING UP AND SHAKER HITS THE GIVE EM’ THE BOOT! BLACKFYRE STUMBLES BACK AND SHAKER GOES FOR ANOTHER BUT LANCE HITS THE OMEN OF DOOMSDAY! SHAKER IS STUNNED! HE PICKS UP JONES FOR THE TITANIC PLUNGE! NO JONES FOLLOWS THROUGH, HE GOES FOR THE 87’! LANCE AGAIN PUSHES OFF! JONES TURNS AND LANCE KICKS HIM IN THE GUT! FEARS ORIGIN! THE SITDOWN POWERBOMB CONNECTS!

Deadprez: COME ON SHAKER! REFEREE DOWN FOR THE COVER!

ONE!!!!!!!!

TWO!!!!!!!

THREE!!!!!!!!

(DING!!!! DING!!!! DING!!!!!)

(Lance Blackfyre falls back on the mats, Shaker kicking out at the last second as the disappointed crowd looks on. The referee raises Lance’s arm….)

Gina Romano: The winner of the match and qualifying for the King of Elite Tournament….. LANCE BLACKFYYYYYRRREEEE!!!!!!!!

(“Old Town Road” (Remix) by Lil Nas X ft. Billy Ray Cyrus plays throughout the arena as Blackfyre stands up and looks down at Shaker with some respect)

Deadprez: The monster qualifies but we cannot say enough about Shaker Jones tonight, he came to fight.

Eve: He did and he put on a show for his fellow Canadians, Shaker Jones showed why he is an elitist and while he may have lost tonight, he came to fight and even Lance Blackfyre seems to be showing him respect.

Gavin Kirkland: Yeah, true but at the end of the day, he lost and Blackfyre will be in the Tournament for King of Elite.

(Shaker Jones sits up and holds his neck, Lance Blackfyre nods and leaves the ring, walking to the back as Shaker slowly gets up listening to the Canadian faithful cheer him on……)

Deadprez: It was an excellent performance from Shaker Jones, but he’s a fighter and he won’t stay down for long. He’ll come back even stronger.

(Commercial break for Road to Redemption as PURE Champion Jake Smith takes on Harlow Reichert on the EAW Network next Saturday!)

( Showdown returns from commercial break as “Toxic Valentine” by All Time hits the speakers as the crowd gives a negative reception for the PURE Champion Jake Smith with the championship on his shoulder. Jake laughs at the reception of the crowd, but it doesn’t seem to discourage him from coming out and calling out Harlow Reichert to the ring.)

Eve: HERE COMES THE PURE CHAMPION!!

Gavin Kirkland: Last week, it was announced that Mr. DEDEDE would not be giving Harlow Reichert a shot at the Answers World Championship. Later in the night, Jenny Punk gave Harlow a shot at the PURE Championship as a way to make up for DEDEDE denying Harlow her rightful match and possibly keep Harlow on Showdown!

Gina Romano: LADIES AND GENTLEMEN… PLEASE WELCOME AT THIS TIME… THE ELITE ANSWERS WRESTLING PURE CHAMPION…JAAAAAAAAAAAAAKKKKKKKKKKKKEEEEEEEEEEEEEE SMMMMMMIIIIIIIITTTTTTTTTHHHHHHHHHHHHHHHHHH!!!!!!

Deadprez: Jake Smith confirmed that he was going to defend the PURE Championship at Road to Redemption; however, we didn’t know WHO was going to be his opponent for the event. He wasn’t too certain with where his opponent was going to come from. It didn’t matter if Jenny Punk gave him his opponent or if he was going to look for one, but he promised that he would be on the card.

Gavin Kirkland: He’s a man of his word. :wow:

(The camera pans to Jake Smith already in the ring. He gets the microphone from Gina Romano, who exits the ring soon after, leaving the champion by himself. “Toxic Valentine” dies down. The only thing heard is the reception of the crowd, who continue to boo him. Probably because they’re in favor of the woman he’s facing at Road to Redemption.)

Jake Smith: I don’t expect to be the most liked guy on Showdown. I don’t come into the ring and pander for your respect or sympathy, but you should admire the fact that whenever I bless you with my presence in the ring, you expect nothing, but the best from me. It’s what you will expect going into Road to Redemption as I put this PURE Championship on the line against a woman who considers herself as the best pure wrestler on the roster. But, she doesn’t have this championship. There’s a reason why I am champion. Yeah, I have amazing in-ring skills, intelligence and everything that correlates with being a champion in this company. This championship solidifies the reason on WHY I am the best pure wrestler on Showdown and possibly, this company. Yeah, my last two matches aren’t the biggest examples. However, I did anything to survive and live another day. I did whatever I can to be at my best going into Road to Redemption. Losing is never an option with me and it’s not going to be an option going into my title defense next weekend. There’s so much that I can say into the ring and expect for Harlow to hear. However, I’ve got nothing to hide or be scared of, so Harlow, I’m calling you out to the ring.

(A few moments pass with the fans anticipating the arrival of Harlow Reichert. Before you know it, “Eye of the Tiger” by New Found Glory hits the speakers as the crowd gives an ovation for Miss No Fucks Given. Harlow comes out and cracks a small smile from the ovation of the crowd. Since Reasonable Doubt, Harlow has faced the most challenging weeks of her live to get her Answers World Championship match from Mr. DEDEDE. It pissed her off that DEDEDE put her through all of those hoops only to deny her the rightful opportunity to face him in the end.)

Eve: Here is the number one contender! After weeks of trying to get her match for the Answers World Championship, Harlow Reichert is denied of the opportunity; however, it seemed like she got a title shot in the end — a PURE title shot. A title that embodies everything that this young woman loves about wrestling.

Gavin Kirkland: I feel like Harlow Reichert will be able to serve her purpose by becoming PURE Champion and take the title to the next level.

Deadprez: If there is anyone in this locker that could give the PURE Champion a pure wrestling match, it has to be Harlow. This young woman is good at what she does and I expect nothing, but a classic pure wrestling match from the two of them.

(“Eye of the Tiger” dies down. Harlow Reichert has a microphone in her hands as she stands across the ring from Jake Smith.)

Harlow Reichert: Let me establish something right now. You’re not the best pure wrestler on the roster. I am.

(The crowd pops of the proclamation as Jake Smith chuckles at Harlow Reichert’s claim.)

Harlow Reichert: Ever since I accepted Jenny Punk’s request to face you for the PURE Champion, I reflected back on our conversation a couple weeks back. All this talk about how you’re the best pure wrestler on the roster because you hold that very championship on your shoulder. Well, could you say that your actions within the past two weeks have been examples of how a PURE Champion should carry themself? With Ahren Fournier, you took advantage of the opportunity of a distraction. I don’t see much wrong with that, but I have to look back in your match last week against Lance Blackfyre and how you needed to low blow the guy in order to get him down to his knees and it’s almost similar to the same things that our previous PURE Champion do and you’re better than that Jake —

Jake Smith: — Didn’t you need to tie up Lance by his legs in order to apply a submission move at him at Midsummer Massacre?

Harlow Reichert: I consider that to be crafty on my part, but that match was no disqualification.

Jake Smith: I consider what I did in my past two matches to establish my craftiness and intelligence. Was the execution popular? To people like you, no. To people who see things from my perspective? Yes. Other than that last match, I say that my track record on Showdown has been fantastic. I defeated two other men on Reasonable Doubt with no ounce of controversy at all. The controversy came from Mark Michaels. I tried my best to play it safe and within the pure rules, but if my opponent wants to bend the rules, I’m not going to take the ass beating and do nothing about it. Lo, I know how to go into title defenses and give everyone the best damn pure wrestling match that they have ever seen. It’s what I did to gain this championship in the first place. I’ve proven on a few occasions that I can live up to the standards of being a pure wrestler. Road to Redemption will be another example of me being the best in the ring and most importantly, better than you.

Harlow Reichert: Fine, I’ll give you that. When going into pure wrestling matches, you have managed to deliver a classic and I want nothing more than to steal the show with you. All this talk about you being the best pure wrestler on the roster and I’m looking to put that to the test. I want our match to stand out from the gruesome chamber matches. I want us to be refreshing and for people to sit back and enjoy the classic wrestling match presented by the PURE Champion and the best pure wrestler on the roster — which is me, of course— and prove that you don’t need a hardcore stipulation to engage a crowd.

Jake Smith: I’m not planning to pull any bullshit in the match. I’m planning to knock out any officials and going chaotic with you. I won’t even put you through a lego table (even though, it’s been so tempting. :mjcry:) because I have faith in my in-ring skills that I can knock down any opponent that steps up to me. Do you pose as a threat to my PURE Championship reign? There’s a part of me that wants to say yes. You are the SECOND best pure wrestler on the roster. You are a woman who constantly gives it her all going into these matches, but you’ve choke each time you’ve stepped into the ring with someone. Everything that you have to offer? You’ve poured into the ring and still, it’s never been enough to walk away with any championship. What makes you believe that this time is going to be different? What makes you believe that everything you do is going to be enough to dethrone me? Let me tell you something: it’s not going to be enough. Nothing will ever be enough for Harlow Reichert to win a championship.

Harlow Reichert: It’s kind of ironic since you’ve constantly been the talk about how you would never reach this point of your career. Now, look at you, Jake; you’re putting me down like others have put you down in the past. It’s what you’ve done with Santo Muerte at Reasonable Doubt. Are you sure that this is a path that you want to go down? Like I said before, you’re better than this, Jake. You’re better than this front that you’ve put up for yourself. Since you’re champion, you believe that nothing is going to knock you off the throne you stand on top of the mid-card division on Showdown. Road to Redemption is going to be your wake up call because I’ll be the one to wipe that smug off your ugly face and take that PURE Championship. I will take the title to the next level and continue to raise the bar that you have with the title so far. I’ll make it THE championship on Showdown. Trust me, with if Mr. DEDEDE manages to do the impossible and leave the chamber still champion, Showdown is going to need a champion that they can be proud of. Jake, you’ve represented that championship very well. Besides, a blemish or two, you have elevated the title from the pits the previous champion and that’s not very difficult to do, but it’s time for a new champion and that’s me.

(The crowd pops after that heartfelt promo from Harlow Reichert, but Jake Smith continues to chuckle, not taking what Harlow says seriously. There, you can see the fire in Harlow’s eyes. She wants nothing more than to take the PURE Championship from Jake. She has a lot of emotions build up within these past few weeks from being put through these small hurdles only to be denied an opportunity at the Answers World Championship and it’s brought a new fire out of her.)

Jake Smith: Whatever you say, Chokelow. According to Jax, that’s all you’re good for —

Eve: HARLOW REICHERT RUSHES FORWARD TO JAKE SMITH WITH A FOREARM! THE PURE CHAMPION IS KNOCKED DOWN AS HARLOW GETS ON TOP OF JAKE BEFORE UNLOADING ON WEEKS OF FRUSTRATION OUT ON HIM! HARLOW DELIVERING SOME NASTY LOOKING PUNCHES AROUND JAKE SMITH!

Gavin Kirkland: Jake Smith manages to push his challenger off of him before making it back to a vertical base, but Harlow Reichert goes right after Jake again, but Jake manages to knee the challenger in the ribs! Jake rebounds off the ropes before delivering a big boot to the side of Harlow’s head as she is knocked down to a seated position! JAKE GETS HARLOW BY HIS HAIR AS HE PICKS UP THE PURE CHAMPIONSHIP, HOLDING IT CLOSER TO HER FACE. HE’S MAKING SURE THAT SHE GETS A GOOD LOOK AT THE CHAMPIONSHIP.

Jake Smith (off-mic): You see this, Harlow? This is the closest that you’re going to get to a championship around here!

Deadprez: HARLOW REICHERT JUST SLAPPED THE SHIT OUT OF JAKE SMITH! JAKE DROPS THE PURE CHAMPIONSHIP IN THE PROCESS AS HARLOW GOES RIGHT AFTER THE CHAMPION! HARLOW WITH A FLYING KNEE STRIKE TO THE CHIN OF JAKE! HARLOW GETS JAKE IN POSITION FOR THE TWISTER — LES MISÉRABLES — THAT BEAUTIFUL COMBINATION FROM THE CHALLENGER! THE PURE CHAMPION IS TRAPPED, BUT HE’S NOT EVEN TAPPING! THIS ISN’T EVEN A MATCH, BUT JAKE IS DOING EVERYTHING IN HIS POWER NOT TO SUBMIT!

Eve: Harlow Reichert is not letting go of the submission move! Harlow is looking to unleash that frustration onto the PURE Champion! Jake Smith is doing everything in his power to fight off the move as you can see the intense look on Harlow’s eyes! She wants to win this match and possibly, more than the champion himself!

(There’s no sign of Harlow Reichert releasing Les Misérables anytime soon. This is enough to make a series of officials race to the ring to pull Miss No Fucks Given away from Jake Smith. After a bit of struggle, the officials manage to pull Harlow away from Jake somehow. Jake manages to roll himself out of the ring. He demands for the official to hand him his title. Once he retrieves it, he raises the title high in the air and stumbles into a seated position. The submission move shook him a bit, but he’s ready for Road to Redemption. “Eye of the Tiger” plays once again.)

Gavin Kirkland: Jake Smith better thank those officials from getting involved when they did. Harlow Reichert probably would have made Jake pass out somehow. However, Jake kind of knew that right buttons to push when talking to Harlow. It’s not a brainer that when you bring things like that to the discussion, Harlow will retaliate and that’s not a side of her that anyone wants to bring out.

Eve: I think this is a match that will truly steal a show! You can all see Jake Smith defend the PURE Championship against Harlow Reichert at Road to Redemption next weekend on the EAW Network!

(The last shot is of Jake Smith looking back at Harlow Reichert in the ring, who gestures for the title on her waist.)

Gina Romano: The following contest in a King of Elite tournament qualifying match, scheduled for one fall!

(“PEOPLE=SHIT” by Slipknot plays to a negative reaction from the Ottawa faithful. Shane Gates slowly emerges onto the stage paying little attention to the crowd. As the camera closes in, he throws up a lone finger, signalling he’ll be the one to win the King of Elite tournament)

Gina Romano: INTRODUCING FIRST! FROM HUNTINGTON BEACH, CALIFORNIA! WEIGHING IN AT TWO HUNDRED AND THIRTEEN POUNDS! “THE DYNASTY OF SHOWDOWN”….SSSSSHHHHAAAAANNNNNEEEEE GGGGGGAAAAAAATTTTTTTEEEEEEESSSSSSSS!!!!!!

Deadprez: It’s been an impressive few weeks for Shane Gates, pulling out victories when it seemed quite unlikely and regardless of the method to do so. A chance to really cement his name as a constant here in EAW with the King of Elite tournament!

Eve: Shane Gates is someone you wouldn’t expect to miss a chance like this. I wouldn’t expect anything else than every possible move, every possible desperate attempt to keep himself in this match and pull out the victory here tonight!

(“Pure Water” by Skepta takes over the PA system but the crowd’s negative reaction remains. A smug and arrogant Dray Fontana steps out from behind the curtain and takes in the jeers from the crowd. He stands on the stage for a moment before walking down the ramp doing little to pay attention to the fans flipping him off along the aisle)

Gina Romano: AND HIS OPPONENT! FROM KINGSTON UPON THAMES, ENGLAND, UNITED KINGDOM! WEIGHING IN AT TWO HUNDRED POUNDS!! HE IS “UNRULY X UNRIVALLED”…..DDDDRRRAAAAYYYYY FFOOOOOOOOOOOOONNNNTTTAAAAAAAAAAAAAAAANNNAAAAAAAAAA!!!!!

Eve: We’ve seen nobodies, nonames, take this tournament by the horns and thrive, seizing the opportunity over the years. At times, it’s been a platform for some to elevate themselves to a new level of notoriety and fame in this company regardless of how deep into the tournament they went and Dray Fontana has a great, great chance to show the world just what he can do!

Gavin Kirkland: We always have our favourites, we always have the few that we expect to make it to the final but there’s always that smokey, that one you don’t expect to make it far. If Dray can win here tonight, he’s my smokey for the tournament!

(DING! DING! DING!)

Deadprez: And this King of Elite tournament qualifying match is officially underway! Shane and Dray circle the ring for a quick moment before meeting in the center of the ring, locking up in a collar and elbow tie up! Jostling for control from the outset of this match, neither man able to overpower the other and instead they break away and back into their respective corners.

Eve: You can see the intent and focus on both men. This is a huge opportunity to breakout not just on Showdown but in EAW as a whole with the King of Elite tournament!

Gavin Kirkland: Of course! Remember King of Elite 2018?

Eve: We don’t talk about King of Elite 2018.

Deadprez: Shane and Dray slowly begin back towards the center of the ring, hands reached out trying to lock hands but neither giving the other an opportunity to do so! Classic grappling for the moment but quickly Shane tries to capitalise, dropping to a knee before shooting back up with his arms wrapped around the waist of Dray Fontana! But Dray quickly fires away with a back elbow before driving himself and Shane back against the ropes! Forcing the referee to interject for the break up!

Ref: ONE! TWO! THREE! FOUR!

Eve: Shane breaks his grip on Dray’s waist and Dray raises his hands, both at the referee’s command. Not looking to get disqualified and throwing away this invaluable opportunity. But Dray once again looks to connect with a back elbow shot once again! Shane Gates had it well scouted and drops to the canvas to the outside of the ring to get some space between himself and Dray!

Gavin Kirkland: GET BACK IN THE RING SHANE! REFEREE!

Deadprez: I think the referee heard you Gavin–

Gavin Kirkland: Really?!?

Deadprez: No. But the referee ushering Shane Gates back inside the ring. Dray giving Shane little opportunity to get back into the ring however. I’m sure he would take a countout victory if it meant he could advance to the King of Elite tournament! But the official isn’t having any of it!

(Dray flips off the referee to a chorus of boos)

Eve: Dray showing no respect whatsoever to the referee but it was the opening Shane Gates needed! Shane races back inside the ring and immediately pounces on the distracted Dray! Shane firing off with left and rights, clubbing blows to the back of the head and the upper spine of Dray Fontana! This time it’s Dray backing into the corner, hoping the referee with interject and pull Shane away. But Shane isn’t allowing his opponent to get a moment of reprieve!

Gavin Kirkland: Shane drags Dray back to the center of the ring before whipping him across the ropes. Dray comes charging, a bit of clarity in his head, looking to connect with a lariat but Shane is quick to duck. Dray drives his feet into the canvas and turns back around but he’s met with a stiff clothesline from Shane! Dray collapses to the canvas and Shane quickly crawls into the cover!

Ref: ONE! TWO–

Deadprez: Dray gets the shoulder up! Shane wastes little time however and quickly rises back to his feet, dragging Dray back to his. But Dray pops up and connects with a knife-edge chop right across the chest! Shane clutches his chest as it immediately turns a bright cherry red. Shane turns back but he’s met with another chop across the chest! He tries to shake it off and swings back with a lariat but Dray ducks beneath and it misses wildly! Dray floats behind and wraps his arms around the waist of his opponent before connecting with a German suplex! Driving Shane back down to the canvas on the back of his neck.

Eve: Momentum has most certainly shifted away from Shane Gates and in favour of Dray Fontana! Little under two months here on Showdown and Dray Fontana might be headed to the first round!

Gavin Kirkland: I wouldn’t count Shane Gates out just yet! We’ve seen him pull off sneaky wins before; he’ll stoop as low as he possibly needs to in order to win!

Deadprez: But I don’t think Dray is giving him the time to get back into this match! Dray rolls Shane over onto his stomach and quickly hooks the leg, traps the arm before wrapping both hands beneath the jaw! The Regal Stretch is locked in and you can already see the discomfort dashed across the face of Shane Gates!

Gavin Kirkland: AH! The Regal Stretch! Dead center in the middle of the ring and Shane doesn’t have anywhere to go!

Eve: Dray has that cinched in deep! That leg is well and truly wrapped and locked in. Shane is scratching and clawing on the canvas, trying to drag himself towards the bottom rope but he’s carrying the entire weight of Dray Fontana on his back, with a single leg and arm to pull himself forward!

Deadprez: Every inch is crucial for Shane Gates but he’s slowly but surely getting closer! Stretching out that one available arm trying to close the distance as much as possible. But Dray tries to cinch the Regal Stretch in just a bit deeper, trying to exhaust Shane as much as he possibly can! But Shane is being stubborn, refusing to give up! Shane makes one greater attempt for the ropes…AND HE GETS THERE! THAT HAND WRAPPED AROUND THE BOTTOM ROPE AND YOU CAN SEE THE RELIEF ON THE FACE OF SHANE GATES AS THE REFEREE BEGINS THE COUNT!

Ref: ONE! TWO! THREE! FOUR!

Eve: Dray breaks the hold! Shane slumps down to the canvas, that sure as hell took a LOT of energy out of him.

Gavin Kirkland: Shane, trying to escape beneath the bottom rope to get a moment to breath. To get some air back into those lungs and hopefully get himself back into a position to win!

Deadprez: But Dray isn’t allowing it. He drags Shane back to the center of the ring and drops down into the cover with the elbow pressed flush across the face of Gates!

Ref: ONE! TWO! THR–

Gavin Kirkland: Kickout from Shane Gates! Shane shoots the shoulder up off the canvas before the three count. Dray looks unphased by it all, he knows it’s going to take a bit more to beat Shane Gates here tonight.

Deadprez: Dray taking a moment to breath and plan his next move as Shane tries to pull himself up off the canvas using the ropes. That arm that was stretched wrapped around the ribs, still feeling the impact of that Regal Stretch. Dray pulls Shane back away from the ropes, Shane trying to fight out of it with a blow to the ribs but Dray responds with an emphatic knee right to the guts! It drops Shane to a knee coughing, trying to regain that breath but Dray doesn’t allow it, he pulls Shane in for the suplex! He hoists him up! Looking to drive Shane Gates back down to the canvas with a brainbuster! But Shane with a knee to the crown of Dray Fontana’s skull!

Eve: And it’s enough! Dray can’t hold Shane up and he might have been stunned! Shane drops back down to the canvas but realises the chance he has! He delivers a swift kick to the back of the knee and Dray collapses; SUPERKICK! Shane Gates with an emphatic superkick right flush on the jaw of Dray!

Gavin Kirkland: Shane isn’t letting this slip by! Dray tries to scurry back to his feet but Shane is there to lock the arms in– DRAGON RUSH! DRAY DROPPED ONTO THE BACK OF HIS NECK! GOOD GOD!

Deadprez: You can see it, you can feel it, Shane Gates sees this match is him the palm of his hands! Dray barely back to a knee, trying desperately to get himself back to a balanced vertical base. Shane is there to meet him though, Shane drags the arm and whips him across to the other side of the ring! Dray comes charging back with intent and purpose– THE PARAMOUNT! THE BICYCLE KNEE! NO! IT MISSED! SHANE STEPS OUT OF THE WAY AND PUSHES DRAY BACK TOWARDS THE OPPOSITE SIDE OF THE RING. DRAY BOUNCES OFF THE ROPES AND HE’S MET WITH A SPINE CRUNCHING SPINEBUSTER FROM SHANE GATES!

Gavin Kirkland: SHANE LOOKING FOR KILL SHOT! DRAY BACK UP TO A KNEE– SUPERKICK! A SUPERKICK FROM SHANE! NO! DRAY DUCKED OUT OF THE WAY AND SHOOTS BACK TO HIS FEET! DRAY COMES RACING BACK….THE PARAMOUNT! IT CONNECTS THIS TIME! IT CONNECTS! SHANE’S HEAD SNAPS BACK FROM THE KNEE RIGHT ON THE JAW! SHANE COLLAPSES TO THE CANVAS CLUTCHING IT AND DRAY FONTANA SIGNALS FOR THE END!

Eve: FLIPPING OFF SHANE, THE REFEREE AND THE FANS MIGHT NOT BE TASTEFUL BUT I DON’T THINK IT MATTERS. DRAY DRAGS AN ALMOST LIMP AND DEADWEIGHTED SHANE GATES BACK TO HIS FEET. HE HOOKS THE ARM BENEATH THE JAW OF SHANE GATES!

Deadprez: FONTANA 97!!!!!! THE STANDING ASAI DDT!!! NO! NO! SHANE CATCHES HIM, HE’S HOLDING DRAY UP ON HIS SHOULDER! SHANE CHARGES THE CORNER– LAWDART! SHANE JUST THREW DRAY INTO THE TOP TURNBUCKLE LIKE HE WAS A JAVELIN! DRAY MIGHT BE OUT, HE MIGHT BE OUT COLD AS HE STUMBLES OUT OF THE CORNER AND SHANE ROLLS HIM UP FOR A PIN, BOTH SHOULDERS PINNED TO THE CANVAS

Ref: OOOOONNNNNNNEEEEEEE!!! TTTTTTWWWWWOOOOOOOO!!!!

Gavin Kirkland: SHANE HAS HIS FEET ON THE MIDDLE ROPES!

Ref: TTTTTHHHHRRRREEEEEEEEEEEE!!!!!!!!

Eve: DAMN IT!

(DING! DING! DING!)

(“PEOPLE=SHIT” by Slipknot plays to a chorus of boos from the crowd as Shane Gates rolls out of the ring with a smirk on his face. The referee exits and raises his hand as Dray Fontana comes to realise he was robbed in the ring)

Gina Romano: HERE IS YOUR WINNER AND ADVANCING TO THE FIRST ROUND OF THE KING OF ELITE TOURNAMENT…SSSSSHHHHAAAAANNNNNEEEEE GGGGGGAAAAAAATTTTTTTEEEEEEESSSSSSSS!!!!!!

Deadprez: We hate to see it, we really do but Shane Gates has made it a bit of a trend in recent weeks to pull out a victory at all costs and this is no different. Now he has a chance to shine on the great opportunity that only comes once a year in the King of Elite tournament!

Gavin Kirkland: Can you imagine possibly calling him King Shane Gates? Good lord no! I can’t imagine anything worse!

Eve: Have to feel for Dray. He was in control for most of this match. The future is still incredibly bright for this young man!

(The camera focuses on Shane making his way up the ramp, celebrating his victory as it fades elsewhere.)

(Showdown returns from commercial break and cuts to the three announcers behind the broadcast booth.)

Eve: Welcome back to Showdown. So far tonight we have had two Elitists qualify for the King of Elite tournament that will kick off in the new year. Lance Blackfyre and Shane Gates have already earned their spots, and gained some momentum heading into next week’s Extreme Enigma Memorial Battle Royal. With that being said, as noted earlier this week, there’s been a change to one of the King of Elite tournament qualifiers.

Deadprez: Jenny Punk announced Kensingten Calhoun-Astor versus Ryan Wilson last week, but that match was changed no to long after the announcement. Candice Blair will be in action later on tonight against Wilson with a spot in the King of Elite tournament up for grabs.

Gavin Kirkland: :noah: It breaks my heart that Kensingten won’t be in action tonight, but the consolation prize of a Latina mami beating the absolute tar out of that ginger looking bitch Ryan Wilson is good enough for me.

Eve: Ugh.

Deadprez: A lot of people have been speculating why the match was changed, but EAW Network host, Molly Waters, managed to unearth some unaired footage from Showdown last week that will shed some light on the situation. Let’s take a look.

(Showdown fades into an unaired segment from last week.)

(SCREENBAR – SHOWDOWN 11.30.2019)

(Kensingten Calhoun-Astor is seen sauntering down the hallway, a look of pure confidence on her face. Earlier tonight, she was victorious in a Specialists Chamber preview match over Candice Blair, and clearly she’s reveling in that. Kensingten comes to a stop in front of Jenny Punk’s office and right as she goes to knock, Jenny walks up behind her.)

Jenny Punk: Kensingten! How can I help you?

(Kensingten whirls around and fixates Jenny with a smug little smile, while looking down her nose.)

Kensingten Calhoun-Astor: Good day, Miss Punk. I need to speak with you about a rather pressing matter.

Jenny Punk: Okay?

Kensingten Calhoun-Astor: Yes. Now I do understand that this little King of Elite tournament is a big deal and all, but I am not interested in being a ‘king’ of anything. While intergender wrestling is a bit of fun, I have no desire to compete in some silly little qualifying match to get into a tournament that honestly I really don’t care about. I do understand that King of Elite is prestigious and all, but if you truly wanted Kensingten Calhoun-Astor in the tournament, you would have just given her an automatic place in it to begin with.

Jenny Punk: Well Kensingten, that’s really not how it works on Showdown.

Kensingten Calhoun-Astor: Miss Punk, I don’t recall asking how it works on Showdown. I am well aware of how things go down, and I’m here telling you that I really don’t feel the need to compete next week against of all people a Mr. Ryan Wilson. My priorities are the Specialists Championship at this moment in time, and beyond that there is a tournament coming up that I care much more about. When you have to start selecting people for the Iconic Cup tournament, then and only then should you speak Kensingten Calhoun-Astor’s name into existence for that. You just need to go ahead and remove me from the match against Ryan Wilson.

Jenny Punk: :skip: Are you really the same woman who spoke about lack of opportunity and are now throwing an opportunity right back in my face?

???: How is that shocking? Biscuit butt just got the biggest win of her life and clearly she doesn’t want the momentum to come to a stop.

(The camera shot widens and Candice Blair walks into the picture. She’s still dressed in her gear having immediately gone to medical after the match earlier. Her shoulder is taped up, but that trademark arrogance is still dripping from her voice. The two Specialists Chamber competitors eye one another and glare.)

Kensingten Calhoun-Astor: How’s your shoulder Miss Blair?

Candice Blair: Popped back in place and ready to go for whenever I’m needed. Unlike you, I’m not the type of dwell on bullshit that just happened. I’m ready to get right back in the ring and show you that victory you just got is the only one you will ever get over me.

Kensingten Calhoun-Astor: That’s tough talk coming from a hooligan who just tapped out to a woman she deemed so far beneath her, Miss Blair. Perhaps you should take a step back and reevaluate what you have gotten yourself into. I might present a pretty package to the EAW Universe but I am far from a pushover inside the ring. I think you understand that now and you can just be on your way. Miss Punk and I were in the midst of a private conversation so good day to you.

(Candice can not help but roll her eyes.)

Candice Blair: If you’re going to attempt to hold the fact I tapped out over my head, then I’m going to tell you right now to save your breath. I’m not so blinded my own ego that I need to prove my toughness and risk a severe injury before Road to Redemption that will hinder my chances at dethroning that hack Darcy. That being said, you have no excuse for not wanting to compete against Ryan. You’re just scared that you’re gunna lose and not look strong heading into Road to Redemption, and that’s the biggest difference between you and I. I’m not going to shy away from a fight and I would NEVER be the person to look a gift horse in the mouth. King of Elite tournament? Count me in. If she doesn’t want to face Ryan next week for whatever bullshit reason, count me in. I’ll face Ryan.

(Kensingten takes one look at Candice’s shoulder and turns to Jenny.)

Kensingten Calhoun-Astor: Yeah. I can’t compete but she can. Let Miss Blair earn her keep and face Mr. Wilson next week. I am sure it will just be the most exciting little match in Showdown history!

(Jenny looks a little unsure about this and she turns her attention towards Candice.)

Jenny Punk: Are you going to be cleared to compete? I don’t take any chances with my roster members. I will do whatever I can to make sure they are protected.

(Candice scoffs.)

Candice Blair: Please. I’m fine. Go ask the doctors. They said I can go back to work outs as early as Monday.

Kensingten Calhoun-Astor: That is so kewt! Miss Punk, you heard Miss Blair. She is more than ready to step in and fight Mr. Wilson to get into the King of Elite tournament. Everyone wins this way.

(Jenny still looks a little bit unsure, but finally she relents.)

Jenny Punk: Alright. If you insist on giving up your match, then I guess Ryan will need an opponent. I guess you’re in the match, Candice.

Candice Blair: And bet that I’ll win the match.

(Kensingten rolls her eyes because she is not impressed, and the footage from last week cuts with the three women looking at one another.)

(Showdown returns to the present and cuts to Gina, who is ready to announce the next match.)

(“Three Ain’t Enough” by Jim Johnston hits as the Ring Master makes his way to the ring with some cheers from the crowd.)

Gina Romano: THE FOLLOWING CONTEST IS SET FOR ONE FALL AND IT IS A KING OF ELITE TOURNAMENT QUALIFYING MATCH!! INTRODUCING FIRST…FROM SALISBURY, MARYLAND…WEIGHING IN AT THREE HUNDRED AND TWELVE POUNDS….THHEE RINNNGGG MMASSTEERR!!!!

Eve: Ring Master is another new guy here looking to make a new guy. He loves to entertain the fans and have a good time. What a chance he has tonight to make an impact.

(‘War’ by Dance With The Dead hits as Santo makes his way out to almost silence from the crowd. He scans the crowd on his way to the ring not taking his eyes off Ring Master.)

Gina Romano: AND HIS OPPONENT…FROM DEATH VALLEY, CALIFORNIA…..WEIGHING IN AT TWO HUNDRED POUNDS…..”THE SAINT OF DEATH”….SSAAANNTTOOOO MMUERRRTTEEE!!!!

Deadprez: What an opportunity for this guy right now. He’s been nothing but impressive since arriving on Showdown. He came up short in his quest for the PURE Title but he;s got a chance to make himself immortal by perhaps winning King Of Elite.

(Ding! Ding! Ding!)

Eve: And here we go! Both men staring a hole through one another and both men lock up in the center of the ring. Ring Master has him in a side headlock now using his weight advantage he has over Santo! Santo pushes Ring Master off him and Ring Master runs to the ropes and rebounds hitting a shoulder tackle knocking Santo to the ground!

(Ring Master taunts over Santo.)

Gavin Kirkland: Ring Master runs to the ropes and now Santo is back up to his feet and leapfrogs over Ring Master’s head and now Ring Master runs off the opposite ropes again and Santo sidesteps it and throws Ring Master through the middle rope to the outside floor! Santo runs to the ropes and charges full speed…SUICIDE DIVE KNOCKING RING MASTER INTO THE BARRICADE!

Deadprez: Santo wastes no time throwing Ring Master back in the ring and now Santo from the outside climbs up the apron and climbs to the top rope and is waiting for Santo to turn around and Santo leaps off the top rope….Ring Master catches him! Belly to back suplex connects from Ring Master! Santo pulls himself up and he’s in the corner and now Ring Master charges at him….Ring Master connects with the splash! Ring Master steps a few feet back and now picks up Santo and connects with a devastating backbreaker! He covers!

OONNEEE!!!

TTWWWOO!!!!

Eve: Santo kicks out! Ring Master knew that wasn’t going to be enough and he runs to the ropes looking for a running body splash but Santo moves out of the way! Santo is back up and throws a kick to the face of Ring Master! Santo grabs Ring Master by his head trying to lift him up but Ring Master picks up Santo high in the air! Santo has a hold of Ring Master’s head though and transitions it into a tornado DDT! Ring Master is trying roll away though as Santo is trying to stop him and Santo now eventually lunges himself on top of Ring Master now and is throwing several haymakers at the face of Ring Master! Ring Master is trying to cover up and now the referee steps in and creates some separation!

Gavin Kirkland: Santo moves the ref and goes back on offense lifting up Ring Master from the mat but Ring Master slaps Santo’s hands away from his and throws a vicious headbutt at Santo! Ring Master lifts up Santo in a powerslam position but Santo slips out form behind and throws a hard forearm into the back of Ring Master’s head! Santo grabs the waist of Ring Master and pushes him forward to the ropes looking to springboard into a pin but Ring Master is able to hand on! Santo is back to his feet and Ring Master is waiting for him with a clothesline!! But Santo ducks underneath and uses the momentum to run at the ropes and rebounds connecting with the slingblade!

Eve: Ring Master walks to Santo and Santo grabs him by the arm and connects with the arm drag across the ring! Santo grabs him by the arm again and flips him on the mat…HE’S GONNA TRY TO BREAK HIS ARM HERE!BUT RING MASTER IS KICKING AT SANTO TRYING TO SAVE NOT ONLY THE MATCH BUT HIS ARM! HE MANAGES TO FREE THE GRIP ON HIS ARM AND HE’S BACK UP AND RUNS AT SANTO THROWING HIS BODY AT SANTO BUT SANTO MOVES AGAIN AND PICKS HIM UP OFF HIS FEET….THE CYCLE CONNECTS! THE SOMERSAULT DEATH VALLEY DRIVER CONNECTS BEAUTIFULLY!! HE GOES FOR THE COVER!

ONNNEE!!!

TTWWWOO!!!

TTHHREEE!!!

Deadprez: RING MASTER STAYS ALIVE! Santo looks a little bit shocked but he knows he can’t waste previous time as he’s up again and picks up Ring Master and irish whips him into the corner but Ring Master counters and throws Santo into the corner! He charges looking for the splash again but Santo gets his foot up stopping Ring Master in his tracks! Santo hops up on the top rope and has Ring Master by the head..DEATH VALLEY DESTROYER FROM THE TOP ROPE!! THE FRONT FLIP PILEDRIVER! BUT RING MASTER HOLDS ON FOR DEAR LIFE SAVING HIMSELF! SANTO IS SEATED TRYING TO COMPLETE THE POWERBOMB BUT RING MASTER LEAPS HIGH AND LANDS RIGHT ON THE CHEST OF SANTO MUERTE!

Eve: Ring Master now can see victory within grasp as he picks up Santo off the mat and lifts him up for the Big Ending!! BUT SANTO COUNTERS IT INTO A REVERSE DDT! SANTO BACK UP AND HOOKS THE RIGHT ARM OF RING MASTER LOOKING FOR THE DEATH NOTE! BUT RING MASTER IS STAYING IN IT THROWING HIS FREE ELBOW TO THE FACE OF SANTO! SANTO BACKS UP AS RING MASTER WALKS TO HIM AND WALKS RIGHT INTO A SUPERKICK!! HE GOES FOR DEATH NOTE AGAIN!! IT CONNECTS THIS TIME!! IS THIS IT?!

OONNEE!!!

TTWWWOO!!!

TTHHREE!!!!

(Ding! Ding! Ding!)

(‘War’ by Dance With The Dead hits again as Santo stands and gets his hand raised.)

Gina Romano: HERE IS YOUR WINNER……SSAANNTTOO MMUEERRTTEE!!!!

Eve: Great match between these two athletes! Santo is gonna be in the King Of Elite tournament and he might be a favorite to actually win it with the skills he possesses. And take nothing away from Ring Master as he put up one hell of a fight. He;s got a great future if he keeps working at it!

( The following scenes have been captured between the dates of 12/1-12/7 )

( “Miserlou” by Dick Dale is consistently heard playing in the background. The first thing we see is an Atlas map, with the first dot on the first location being New Hyde Park, New York. )

( SCENE 1: Open to Bowlmor Long Island Lanes in Melville, New York; where Xander Payne is at the bowling alley with his wife, Payton, and his two children. His wife steps up to the aisle first, and the scoreboard screen above their lane shows her and the two children several points ahead of Xander in the competitive family game. Xander addresses the camera. )

Xander Payne: One thing that you need to know about me is the simple fact that I do NOT, under any circumstances, enjoy losing. But if there’s one place you absolutely can never win at all times, it’s at home with the family. See the people in this chamber match would know nothing about that. DDD has enough illegitimate children out there to start his own grade school, Jamie and Cameron find themselves coming to blows like every other year, Chris Elite can’t keep a girl satisfied to save her life and Mark Michaels has probably never even come into the vicinity of a woman. They wouldn’t know anything about creating a stable household. But see don’t get it twisted, it may be give and take at home –

( Xander’s wife Payton jumps and cheers in celebration after knocking out every pin in one attempt. The kids clap and congratulate her. )

Xander Payne: It may be give and take at home, but in EAW there’s a different kind of give and take. I GIVE out the beatings, and I TAKE all of the accomplishments for myself. I bring the pain and punishment to my opponents in every single match, and bring home whatever accolades I can take for myself. Road to Redemption isn’t gonna be any damn different-

( Xander’s daughter asks him for five dollars to grab a soft drink. He digs in his pocket and hands her a 10, and she runs off with glee. )

Xander Payne: (to his daughter, now off camera) MAKE SURE YOU BRING ME THE CHANGE. (to himself) Five dollars for a fucking soda pop, unbelievable. (to the camera) As I was saying, Road to Redemption won’t be any different. Look at the trail of bodies I’ve left in my wake. Look at the people I’ve broken along the way. First that rat bastard Myles, then that ugly smelly hobo Darkane, then that little weasel Lucas Johnson. I guess the only real question to ask now is simply who’s next? Well, we aren’t too far away from finding out. But I guarandamntee you of this, when it comes to the five total scrubs joining me in my home province of Ontario, all you have to do is line them up.

( Xander Payne rips open the gym bag in front of him and pulls out his weapon for the Extreme Elimination Chamber: a barbed wire bowling ball. )

Xander Payne: And like a full set of bowling pins, I’ll knock ’em down.

( Xander Payne gets up, grabs the nearest bowling ball, and before it can reach the end of the lane we transition elsewhere. )

( The Atlas map transitions up from Melville, to the Avenue I subway station along the F line in Midwood. Chris Elite and Big Mike are there at night and are being followed by a worn and haggard looking homeless man who continues to ask them for the time of day. )

Big Mike: Yo chief I told you I ain’t got a lighter on me, I’m not gonna say it again. Leave us alone NOW.

( Big Mike’s voice echoes, and the homeless man quickly walks the opposite direction not wanting any trouble. Chris Elite removes his air pods and puts them in his jean vest pockets, and then pulls his hood down. )

Chris Elite: You a big intimidating motherfucker you know that.

Big Mike: Way to state the obvious.

Chris Elite: Deadass, you could be a full time wrestler. The transition would be easy, too. Just get used to taking some bumps and find yourself a finishing move and you’d fit right in. Shit, you could fuck around and become a champion, even.

Big Mike: I guess, I like what I’m doing now though.

Chris Elite: You would have to get over your irrational fears though, Asson told about what happened, that shit was just sad B :skip:

Big Mike: Son I already told you a million times before I’m claustrophobic. I don’t do well with tight spaces, I cannot help it.

Chris Elite: You gonna need to get over that shit ASAP.

Big Mike: For what though? I am who I am, I don’t see the big deal.

Chris Elite: Look you guys did a really good job last week getting me the information I need for this new chamber. Thanks to y’all I already got a chance to use my Gawd Contract to make some modifications to the chamber as it is. (1) I had them ban that stupid ass remote so that these non Gawd Contract having bums don’t enter the match before me. (2) I had them fix the floors inside of the chamber pods so no one can do that stupid El Chapo shit that Theron did last year. (3) I got rid of the “Contract For Anything” because I’ll be damned if I win that chamber and somebody wants to come out and rain on my parade. I’m fully prepared for this thing all I really have left to consider is who… or importantly who I’m gonna have as a weapon.

( Chris Elite looks up at Big Mike, and Mike seems confused at first, but a lightbulb goes off in his head and he begins to side eye Chris. )

Big Mike: Nahhh….

Chris Elite: Come on bro.

Big Mike: Nah dude, nah. No! Me?! You want ME in there?!

Chris Elite: Why wouldn’t I pick you?

Big Mike: Because I’m a human being! That isn’t even allowed!

Chris Elite: As far as I’m concerned you are a walking weapon. And I have the Gawd Contract dummy I can do whatever the fuck I want. We’re just going to have to spend some time working on your irrational little fear of tight spaces. Trust me I’m not tryna share the same chamber pod as a grown ass man either :dame: but in this place it’s necessary. Road to Redemption is going to be the biggest night of my career by far, even bigger than Road to Redemption 2017. I have two gothic treesh edgelords and five overhyped bozos, that’s all that’s standing in my way of the money and power that comes with being World Champion again, AND Tag Team Champion AND Triple Crown Champion. We was eating good as hell off that World Title commission a year and some change ago. Imagine the prosperity this time around.

Big Mike: (sigh)… :noah: !!!!

( The Atlas map transitions from the Subway station – across the continental United States – to The Channel Islands just off the coast of Santa Barbara. It is in these beautiful, serene waters where we see a private Yacht with Jamie O’Hara sitting out on the deck in nothing but his little Speedos, sipping on some moonshine and playing on the banjo to the tune of “Khe Sanh” by Cold Chisel. “Miserlou” temporarily stops. )

“I left my heart to the sappers round Khe Sanh!
And the soul was sold with my cigarettes to the black market man!
I’ve had the Vietnam cold turkey!
From da ocean to the Silver City!
And it’s only other vets could understand!”

( Cameron Ella Ava walks out from the inside cabin wearing a silk bathrobe over her bikini, holding her phone in her hand. )

“About thurr long forgotten dockside guaranTEES
How there were noooo V-day heroes in 1973
How we sailed into Sydney Harbor”

( He looks up at Cameron Ella Ava who is now standing in front of him. )

“Saw Cam but I couldn’t kiss her
She was laaaaned and ahhhh was home to the lucky land!”

Cameron Ella Ava: Day drinking? Without me? How dare.

( “Miserlou” picks back up. )

Cameron Ella Ava: And for the 1000th time, when were we going to show each other our weapons for the Elimination Chamber? I’ve been dying to see which one you have.

( Jamie O’Hara pulls off his shades, showing his eyes wide open in shock. )

Jamie O’Hara: FUCK! I COMPLETELY LEFT THEM AT HOME!

Cameron Ella Ava: Yeah, luckily I made sure to bring them.

( Time elapses. Cameron Ella Ava places two concealed briefcases on the floor of the Yacht deck. Jamie O’Hara is standing beside her, albeit a little tipsy. )

Jamie O’Hara: You’re a real lifesaver. Ya sure ya didn’t peek, did you?

Cameron Ella Ava: No. :unamused:

Jamie O’Hara: Ya sure?? Not even a little gander? I wouldn’t mind, really.

Cameron Ella Ava: I wanted us to be the first ones to see each others weapons for the match, although mine is probably a bit more predictable than yours.

Jamie O’Hara: Let’s raise the stakes a bit then, why don’t we? Being that we’re already down to our sluggos, the one who guesses wrong has to let the other dropkick them into the sea.

Cameron Ella Ava: What if we both get it wrong?

Jamie O’Hara: In that case, we’re both going for a swim.

Cameron Ella Ava: What if neither of us get it wrong?

Jamie O’Hara: Will ya just play the fucking game Cam

Cameron Ella Ava: Fine fine. You go first.

Jamie O’Hara: Hmmm…

( Jamie O’Hara kneels forward and attempts to rattle the briefcase containing Cam’s weapon in it. Cam slaps his hand away. )

Cameron Ella Ava: THAT’S CHEATING!

Jamie O’Hara: :damn: OK alright, um… shit….

( Jamie takes a second to ponder. )

Jamie O’Hara: You strike me as a brass knucks kinda gal.

Cameron Ella Ava: Is that your final answer?

Jamie O’Hara: Nah. I know how you work, yer all about da symbolic stuff. Seeing as how it’s already sealed the deal for you at the same event, against the same opponent just one year before, Imma go with the diamond studded little taser shooter you got there.

Cameron Ella Ava: YOU HEARD IT DIDN’T YOU! CHEATER!

( Jamie O’Hara cackles and opens up Cam’s briefcase, revealing her weapon in the Extreme Elimination Chamber: a diamond studded taser, the same she used to make the current champion Mr. DEDEDE scream “I Quit” just a year prior. Jamie picks it up and admires the craftsmanship of the specialized weapon. )

Jamie O’Hara: She’s a beauty.

Cameron Ella Ava: Well, considering you got a haptics preview it’s only fair that you at least give me a hint.

Jamie O’Hara: User yer noggin, Cammy, come on.

Cameron Ella Ava: Well every time you’ve been inside the Extreme Elimination Chamber, you’ve used the sledgehammer as your weapon. Sure you’re not stupid enough to use the same weapon three chambers in a row.

Jamie O’Hara: HEY, there’s nuthin stupid about a sledgehammer. Especially one that you can hide easily in yer tights like your ex boyfriend did that one year.

Cameron Ella Ava: That sounded just wrong… come on, couldn’t you at least give me some sort of clue? Tell me what it’s made of!

Jamie O’Hara: Hmmmm…. Wood.

Cameron Ella Ava: What it is a long, wooden dildo?

Jamie O’Hara: Could be. You never know.

Cameron Ella Ava: Is it that banjo or something?

Jamie O’Hara: Nah. The predictable old fuck’s bound to bring in his stupid Equalizer, last thing I wanna give the bloke is any excuse he can at thinking I’m tryin’ to imitate him. But let’s just say my weapon’s in that same ballpark. Not the same exact musical instrument, but enough to make four other cunts sing soprano.

Cameron Ella Ava: I’m totally lost.

( A grinning Jamie O’Hara picks up his briefcase and pulls out: a barbedwire wrapped didgeridoo. He begins to play on the instrument, while Cameron tilts her head to the side. )

Jamie O’Hara: Finely crafted eucalyptus wood Didgeridoo, solid finish with a tightly wrapped barbedwire coat for a little bit of flare.

Cameron Ella Ava: A didgeriwhat??? Yeah, no way was I gonna guess that, I don’t even know how to spell Didgeridoo.

Jamie O’Hara: Well do you know how to spell ADubyaC? Because that’s exactly what I’ll be come the end of Road to Redemption. Hey speaking of ADubya”C”, why don’t you “see” your way into the “sea” since ya lost our little bet just now.

Cameron Ella Ava: Yeah sorry, I’ll have to take a rain check on that. The only thing I “see” is myself on the homepage of EAW.com Sunday morning holding up MY Answers World Championship, thank you very much.

Jamie O’Hara: Orly. We’ll just have to “see” about that one. Won’t we?

Cameron Ella Ava: Si.

( The atlas map zips across the continental United States, back to the east coast, and lands in Newark, New Jersey just outside of EAW Headquarters during the middle of the day. Mark Michaels is seen walking side by side with his manager in one of the indoor hallway bridges connecting wings, with windows that overlook the campus grounds. Michaels is dressed in a professional button down attire and black slacks with fine brown shoes and a golden watch around his wrist. However he appears to be visibly upset, just getting off the phone with his manager. )

Mark Michaels: I’m sure it’s no secret that my EAW contract is set to expire December 31st of this year, and the insufferable suits running this company and this entire industry into the ground refuse to acknowledge my worth. Day in, day out, week in, week out, FPV in, FPV out, year in, year out I am CONSISTENTLY the hardest working man in this entire fucking company. I push my opponents to their limits, I force them to tap into places they didn’t even think they had, I test them physically and mentally. I was the shining example of what a champion in Elite Answers Wrestling looks like. I took that PURE Title to levels that no other person in this company could dream of. While our chairman sat his silver spoon ass on the sidelines spouting this cockameme excuse of “load management”, I’ve been redefining the very meaning of work ethic.

And for what? To be told no. To be told to my face that I’m not worth as much as I think I am. To essentially be laughed out of the room by these money grubbing hollow vessels in their neckties, slaving away before their corporate master. Only for them to tell me what they think I’M WORTH, like I’m going to lie down and accept that. To hell with that. Here’s how it’s going to be. I’m not resigning my goddamn contract come December 31st, 2019 unless it’s as the Answers World Champion. I’m not entering the new decade as an EAW Elitist unless I’m entering the new decade holding the biggest prize in the entire sport. If these motherfuckers want to see their Answers World Title in their own fucking company and not in a different promotion, they’re going to have to make it worth my while. And nothing adds to your worth quite like being the World Champion.

I don’t regard Jamie O’Hara. I don’t respect Chris Elite. I don’t acknowledge Cameron Ella Ava. I don’t give a damn about Xander Payne. And I don’t fear Ryan Adams. I know I’m capable of defeating all five of them. Elite and O’Hara are washed up former World Champions who have become complacent, they don’t know the meaning of possessing the hunger that I possess. Unless we’re talking about that fat fucking dingus Xander Payne, now that’s just a different kind of hunger. But he’s too lazy to hit the fucking gym and burn a few pounds, what makes you think he’s going to outwork me in the wrestling ring? Cameron is second fiddle, as usual. If she isn’t taking the backseat to her husband, she’s taking the backseat to her own sisters. She’s too used to being the supporting cast character to go out on a limb let alone go all out. She’s bound to go out on her back the same way she does every night when she spreads her legs for her armani model twink for a husband. And that sack of shit Ryan Adams is the most overrated, undeserving, overcompensating piece of trash the world has ever seen. He’s too concerned with selling his snake oil to be a true champion. I would run circles around him with that belt, I would completely reshape the perception of being champion and bring it back to what it should be. The workhorse, the pillar, the leading light, the example of excellence.

( Mark Michaels asks his manager to hand him his pull string bag. )

Mark Michaels: That is Mark Michaels personified, and this company – just like my opponents – may be too dense to give me the respect that I deserve.

( Michaels pulls out a lead pipe from the drawstring bag, showing it to the camera. )

Mark Michaels: So I’m just going to have to beat into their thick heads. One crushing blow at a time.

( The atlas map moves up to Ottawa, Ontario, and we open to present day backstage at Saturday Night Showdown where Mr. DEDEDE is hand in hand with Kassidy Heart. The two climb up the steps ready to enter DDD’s customized Featherlite Vantare Platinum Plus Luxury Tour Bus, aka the “Gawdshuttle 8000”, while their handlers are putting their luggage into the luggage doors of the bus. DDD and Kassidy enter the bus, but before the camera can follow DDD and Kassidy through the curtain, Kassidy stays behind and stops the cameraperson in their tracks. )

Kassidy Heart: Sorry, absolutely no cameras inside the Gawdshuttle. This is about as far as you go. We’re not taking any interviews either, although in your case you’re probably only here to find out what weapon The Gawd is going to bring into the Extreme Elimination Chamber. As if it isn’t already painfully apparent. It’s obvious what both of our go-to weapons will be, after all we’re only talking about the deadliest instrument of violence in the history of Elite Answers Wrestling. That of course, for the slow and the ignorant, being The Equalizer. But before you trying to interview me like you’re TMZ and ask me questions, let me ask you one. Have you ever wondered why it was named “The Equalizer” in the first place?

I did. So I picked my lover’s brain on the naming of this item and he told me very simply: The Equalizer is made to slay giants. Easy enough, right? But what happens when you are the giant? What happens when you’re the most powerful individual in the room? What happens when you’re the deadliest? The most sadistic? The most ruthless and sinister human being in the room, capable of mauling and dismembering everybody in it? Imagine what kind of weapon an instrument made to slay giants is, when it rests in the hands of a giant. It isn’t just a tool for destruction at that point. It becomes a weapon of mass destruction. And in seven short nights, all of the death, destruction and gore that you can ask for will be in heavy abundance. You can expect nothing but chatter until then. The back and forths and bickering that’s become customary leading into major events. But when that familiar crash of the guitar is heard, followed by the subsequent splattering of blood hitting the canvas, it won’t be much of an Equalizer then. More like a silencer. And that’ll truly speak the loudest. Test us not.

( Kassidy walks through the curtain and slams the mantrap door to the bus shut, effectively ending the Pulp Fiction scene. )

(The scene fades into backstage with Showdown General Manager Jenny Punk who is in a middle of a conversation with a newcomer, who looks more than excited to be on Showdown. The young woman’s smile radiates the room, even making the somewhat serious General Manager catch that smile.)

Jenny Punk: I’m more than stoked to have you apart of my roster, Harper. Just seeing your tryout match against Sierra Bradford made me think of the potential that you can reveal on Showdown. Take someone like Harlow Reichert for example, she seemed like nothing more than another name on Empire. She was a tremendous wrestler and when given the microphone, she can make you feel the same emotions that she’s feeling. Not much Elitists are able to do that, but Harlow is different from a lot of the Elitists on this brand. During this season on Showdown, I have been amazed to see someone like Harlow grow and evolve to the woman she is today. She has the possibility of becoming the next PURE Champion. There’s no doubt that you’ll find yourself going down the path if you put your mind to it.

Harper Lee: I’m super excited to be part of Showdown. I was low key hoping to find myself on the brand because the competition on this brand – it’s terrifying, but I’m excited to step inside the ring with any man or woman you put me up against. I only have a few weeks of experience underneath my belt, but I feel like if you put me up against some of the best, I will surprise people. I mean, people were familiar with how much Drake King, who helped me train these past couple weeks before my tryout. No one saw him as anything more than someone who shouted “OK,” but we saw him do amazing things on the Showdown brand. He got victories over former World Champions like Ahren Fournier. We saw him shock the world by eliminating the Heart Break Boy at least year’s Road to Redemption.

Jenny Punk: He also kidnapped the last general manager and made Terry Chambers’ life a living hell last season. :lupe:

Harper Lee: I’m not going to do that. I promise. :whoa: Drake may have had a hand in my training, but I’m not him whatsoever. Don’t be expecting me to kidnap and intimidate authority figures. I want to make sure that my dedication for this sport shines through on Showdown. I am super passionate about this sport and everyone may — or — may not, be surprised about my extensive knowledge about EAW as a whole. One of the things that Drake tried to advise me with is do as much research as possible and never come to any matches uninformed about the opponent I’m squaring off against.

Jenny Punk: Did he give you any other advice?

Harper Lee: Oh, he told me not to curse. If I say a bad word, he’ll know. :lupe:

Jenny Punk: You mean…that’s not an act? Drake King really doesn’t curse or anything?

Harper Lee: Never. He’s never really felt the need or been tempted to curse. I admire his dedication and I could only to have as much dedication in this company as he does when it comes to not cursing. I have ate, sleep and breathed wrestling for as long as I could remember. This is what makes Showdown so amazing for me to start on because it has some of the best wrestling in EAW. I want to be a part of the action, Jenny. When can I start?

Jenny Punk: Well, I have the perfect spot for you to shine in. On Voltage, Captain Charisma announced the repackaging of the Extreme Enigma Elimination Match into the Extreme Enigma Battle Royal at Road to Redemption. The prize is a beautiful trophy and a $100,000.00 check for the winner of the match.

Harper Lee: There’s a lot of things I can buy with $100,000.00. :oh:

Jenny Punk: The offer is tempting and most importantly, it gets you a platform to shine in before we debut you on Showdown. What do you say?

Harper Lee: Put me in, Jenny! This is going to be great! If it gets me to showcase myself, I’m all in for the opportunity! I won’t let you down!

Jenny Punk: That’s the spirit!

(Harper Lee leaves Jenny Punk’s office more than excited with this fantastic opportunity. Not only is the prize money fantastic, but a way to honor a great Elitist that was taken away from us too soon. The scene fades elsewhere.)

(Showdown returns from break and “Hell on Heels” by the Pistol Annies is playing inside the building. The camera cuts to the broadcast booth where Specialists Chamber competitor Kensingten Calhoun-Astor is seen putting on a headset and getting settled in. She is seated next to Gavin Kirkland, and he is practically drooling over The Steel Magnolia. Kensingten cuts him a glare and waves her delicate lace gloved hand at him.)

Kensingten Calhoun-Astor: You can place that tongue right back in your mouth Mr. Kirkland. Lusting over me is not a good look for you and I say with the utmost certainty that it will get you nowhere.

(Unfortunately for Kensingten, Gavin is always up for a challenge.)

Gavin Kirkland: Do you know what this tongue is capable of, my sweet Southern belle?

Eve: :whoa: We are back on air. Ladies and gentlemen, as you can see Kensingten Calhoun-Astor will be joining us on commentary for this match.

(“Diva” by Beyoncé begins to blast, which causes the fans inside the arena to get to their feet. They give Candice Blair a nice ovation as she walks out onto the stage.)

Gina Romano: LADIES AND GENTLEMEN, THE FOLLOWING CONTEST IS SCHEDULED FOR…

Crowd: ONE FALL!

Gina Romano: AND IT’S A KING OF ELITE TOURNAMENT QUALIFYING MATCH! INTRODUCING FIRST, HAILING FROM SAN FRANCISCO, CALIFORNIA… WEIGHING IN AT 126 POUNDS… PLEASE WELCOME ‘THE HOT COMMODITY’ CANDICE BLAIR!

Kensingten Calhoun-Astor: I wonder how Miss Blair is feeling after catching a baseball bat to the skull last night on Dynasty? Between that and her precious little shoulder injury, this could very well be a long night for her.

Eve: Well, with all due respect, this was your qualifying match for the King of Elite tournament, and something tells me that there’s a little bit more to your claims that you didn’t want to compete. Any Elitist would be beyond thrilled to compete in the yearly tournament, but I’m inclined to believe what Candice says. Are you afraid of losing your momentum before the Specialists Chamber?

Kensingten Calhoun-Astor: Miss Eve, Kensingten Calhoun-Astor is not afraid of anything, and you are more than welcome to worry that pretty little head of yours about things that are of absolute no concern to you. I gave up this match because I simply don’t feel the need to attempt to qualify for this tournament. There are more important things on the horizon for me, and the little tin crown that the winner gets is not one of them.

Deadprez: The King of Elite gets a world championship shot of their choosing, though. Who wouldn’t want that?

Gavin Kirkland: Why are you questioning her?! Kensingten is about to become the Specialists Champion and she doesn’t need anything else but that right now.

Kensingten Calhoun-Astor: Exactly. You are a smart cookie, Mr. Kirkland. I can only do one thing at a time and right now my focus is that kewt little Specialists Championship.

(Candice has gotten in the ring and she takes a moment to glare at the woman who is quickly becoming her rival. Kensingten blows Candice a kiss and waves at her, which prompts Candice to just roll her eyes.)

(A few seconds later, Candice’s music fades out and is replaced by ‘My Way’ by Limp Bizkit. The crowd begins to jeer as Ryan Wilson walks out.)

Gina Romano: AND HER OPPONENT… FROM MONTREAL, QUEBEC, CANADA… WEIGHING IN AT 212 POUNDS… HE IS ‘THE AGENT OF CHAOS’ RYAN WILSON!!!!

Gavin Kirkland: At Road to Redemption, Ryan will be competing in the Extreme Enigma Memorial Battle Royal. If he can knock off the sexy little Candice Blair tonight, he’ll get himself some major momentum going into next weekend.

Eve: I would definitely say that Ryan is one of a handful of Elitists who have a chance at winning the battle royal next weekend, and with 100,000 dollars on the line?! I’m pretty sure he will pull out all stops in order to win.

Deadprez: Ryan could definitely set himself up for a fine Christmas with back to back wins tonight and at Road to Redemption. We’re about to find out if he can get the job done against Candice.

Kensingten Calhoun-Astor: I’m almost certain that he will.

(Ryan gets into the ring and gets himself set. The referee checks with Candice, who signals that she is ready as well. He calls for the bell and gets the match under way.)

(Ding! Ding! Ding!)

Eve: This is only Candice’s second singles match here in EAW, but she has a massive opportunity to get into the King of Elite tournament. I can’t believe you would give that up, Kensingten.

Kensingten Calhoun-Astor: Bless your heart, Miss Eve. It’s really not your place to question me or what I decide to do with my time here in Elite Answers Wrestling so stop harping on it! AGAIN. My focus is not on some silly tournament for a cheap crown. I don’t need to be the ‘King’ of anything to prove my value. I’m sure there are plenty of people who would find that sort of little thrilling, but Kensingten Calhoun-Astor is not most people. So why don’t you focus your precious attention on the match at hand.

Gavin Kirkland: 🤤🤤🤤🤤 gawd I love you.

Deadprez: There is a match that’s started and Blair and Wilson are circling one another. It’s Ryan who makes the first move, and he lunges for Candice, only to have her duck and slip behind him, looking for a waistlock. Ryan looks to connect with an elbow but Candice ducks and attempts to bring Ryan down to the mat. He locks his hands around hers, and blocks to attempt, and he reaches down, jerking Candice’s feet out from under her! Candice hits the mat and Ryan immediately runs the ropes! Candice is up and leapfrogs over Ryan! He hits the opposite set of ropes, which brings him right back towards Blair! Candice looks for a crossbody, but Ryan catches her in the air!

Gavin Kirkland: Ryan hoists Candice on his shoulder and walks over to the corner, but Candice breaks free and lands on her feet! She pushes Ryan from behind and he collides chest first with the turnbuckles, which allows Candice to roll him up!

OOONNNEEE!!!

TTTTWWWW-

Eve: Ryan is quickly out and back to his feet! He rushes the ropes once again and Candice catches him on the rebound! She attempts a hip toss, but Ryan blocks it and tries to bring Candice down with an arm drag! She blocks that! Ryan sweeps her feet out and quickly goes for a cover, but Candice is out before a one count can even be made! Both competitors are back up and lock up, exchanging various chain wrestling techniques! Ryan finally brings Candice down with a waistlock slam, and he goes goes for a cover!

Deadprez: Candice bridges up and slips out of the pin, but Ryan jerks down her and she slams face first into the mat!

Gavin Kirkland: Dat flexibility 🤤🤤🤤

Kensingten Calhoun-Astor: Calm down, you nasty.

Deadprez: Ryan grabs Candice in a front facelock, and she’s forced to grab him by the hair and pulls his head back! Ryan lets go, and that causes the referee to step in and start admonishing Blair. She ignores the ref and kicks Ryan in the head, causing him to roll towards the ropes. Ryan looks to get back to his feet, but Candice connects with a dropkick to his ankle! She quickly places his ankle on the ropes and leaps in the air… bringing all 126 pounds down on that ankle! Ryan quickly pulls himself out of the ring and drops to the mat, and guys, he is grabbing that ankle.

Kensingten Calhoun-Astor: Well, Miss Blair clearly isn’t as dumb as the rest of her kind. It’s an efficient strategy to target a body part. I mean after all, yours truly did just that last week and caused Miss Blair a certain little level of discomfort this week.

Gavin Kirkland: Mami is out of the ring and she’s stomping away on the ankle. Ryan Wilson tries to defend himself, but Candice jerks his leg up and stomps away on the opposite thigh! She slams Ryan’s leg into the ground! She grabs his ankle and begins to pull him over to the ring steps. Candice quickly rips apart the steps and I admire this passion, this fight. That hot, Latina temper! She places Ryan’s ankle between the ring post and the step. A smile crosses her face and she just uncorks a huge kick to the steps!

Eve: BUT RYAN GETS HIS ANKLE OUT OF THE WAY! If Candice would have connected with that, surely Ryan’s ankle would have gotten crushed and he could have kissed any chance he had at advancing in the tournament goodbye!

Deadprez: Candice isn’t deterred though! Ryan is using the ring skirt to pull himself up, but Candice nails in the back with a series of perfectly placed kicks! She grabs Ryan by the head and slams his face off the hardest part of the ring, and she throws him back inside the ring! Candice climbs back into the ring herself and she reaches down to grab Ryan! Ryan fires back with a massive right hand and that sends Candice staggering back! That gives Ryan a bit of a break and he pushes himself up to his knees! Candice comes flying back, looking to connect with a running knee!

Eve: Ryan catches Candice and flips her down onto her back! He grabs Candice’s legs and goes for a pin!

OOONNNEEE!!!

TTTTWWWW-

Kensingten Calhoun-Astor: She kicked out. That’s unfortunate.

Gavin Kirkland: Candice and Ryan both get back to their feet but Ryan is clearly hampered by that hurt ankle. Ryan offers a test of strength but Candice isn’t about to fall for that! She unloads a right hand and follows it up with a left! Ryan is forced back into the corner and he covers up! The referee tries to get in the middle of the two competitors, but Candice breaks on her own and takes a minor step back. That allows Ryan a chance to quickly kick Candice in the gut with his good leg and he quickly grabs her around the neck, looking to spike her with a DDT! Candice elbows her way out and grabs Ryan’s arm, looking to bring him down with an arm drag. Ryan catches her right in the jaw with a massive right hand, and this time he is able to firmly plant Candice’s skull into the mat! Ryan Wilson with a cover!

OOONNNEEE!!!

TTTTWWWWOOOO!!!!

Deadprez: Candice got her foot on the ropes though!

Eve: Ryan pulls Candice up by the hair and bullies her into the corner with a series of forearm shots! Ryan grabs Candice by the hand and looks to whip her across the ring, but Candice plants her feet and tries to land a punch to the side of Ryan’s head! Ryan blocks the shot, and sends Candice across the ring! She slams back first into the corner and Ryan flies forward, hitting her with a corner clothesline! Ryan grabs Candice by the hair and runs forward, bringing her down to the ground with a running bulldog! Candice is down and Ryan heads for the ropes! He uses them to spring himself in the air lands a Lionsault!

Gavin Kirkland: But he’s unable to make the cover! Ryan is grabbing at his ankle and he might have hurt it worse by going for such a risky move like a Lionsault! Ryan finally shakes off the effects of the flurry of offense he just unleashed, and he crawls over to Candice and goes for the cover!

OOONNNEEE!!!

TTTTWWWWO-

Eve: Candice kicks out!

Kensingten Calhoun-Astor: How kewt. I thought for sure Miss Blair would feel at home flat on her back with a man on top.

Gavin Kirkland: Let me get on top of you :mjlit:

Kensingten Calhoun-Astor: When I slip into church in the morning, I will certainly pray for you Mr. Kirkland.

Eve: Ryan has pulled Candice up and he gets her into position for a snap suplex! Candice hits the mat hard and Ryan drags her to the ropes, draping her tender shoulder across the middle one! Ryan backs up and uses the ropes to propel himself forward and he lands a basement style dropkick to that shoulder! Candice is in a tremendous amount of pain!

Kensingten Calhoun-Astor: Now this match is interesting!

Deadprez: Ryan drags Candice to the center of the ring and goes for another cover!

OOONNNEEE!!!

TTTTWWWW-

Gavin Kirkland: Candice kicked out again! With a spot in the King of Elite tournament up for grabs, and Candice wanting to get some momentum for the Specialists Chamber, she’s determined to keep fighting! Ryan gets back up to his feet and he stomps away on her shoulder! Candice rolls to her side, and Ryan begins stomping all over her body. Candice Blair is in trouble and Ryan finds himself heading to the corner! I don’t know why he’s going to try another high risk move. He should be focusing on keeping Candice grounded right now, and continue to work that shoulder! Ryan heads to the top rope and he gets himself set! Ryan flies! Swanton Bomb!

Deadprez: BUT CANDICE ROLLS OUT OF THE WAY! RYAN IS DOWN!

Eve: Both competitors are taking this time to catch their breath and recover from what has been a great back and forth match so far.

Kensingten Calhoun-Astor: Oooh! Mr. Wilson is up first and he’s got Candice by those cheap little extensions!

Gavin Kirkland: Ryan forces Candice back into the corner and chops the hell out of her! Candice immediately grabs her chest and Ryan drops a hammerfist down on that shoulder! Candice drops to her knees, and Ryan catches her in the face with a swift little kick, and the back of Candice’s head slams into the turnbuckle! Ryan pulls her out of the corner and slams her face into the mat! He jerks Candice up by the hair once again and sits her up on her feet… ONLY TO HIT HER WITH A SUPERMAN PUNCH! CANDICE GOES DOWN LIKE A TON OF BRICKS AND RYAN QUICKLY GOES FOR THE COVER!

OOONNNEEE!!!

TTTTWWWWOOOO!!!!

TTTTTHHHHHRRRRREEE-

Kensingten Calhoun-Astor: NO!

Deadprez: CANDICE BLAIR CONTINUES TO FIGHT!

Kensingten Calhoun-Astor: That is complete hogwash! That Superman Punch should have taken her out!

Gavin Kirkland: Ryan looks a little shock that it didn’t! He’s slow to get back to his feet and he brings Candice back up to hers! Ryan unloads another chop to Candice’s chest and looks to whip her into the ropes! Candice someone ducks on the rebound and she hits the ropes, locking her arms around them! Ryan comes flying towards Candice but she hangs onto the top rope and drops down! Ryan’s moment sends him to the ground and he lands awkwardly on that already injured ankle! Candice quickly slides out of the ring and begins kicking the hell out of it! She’s gotten a second chance in this match and she pulls Ryan up and slams him back first into the apron of the ring!

(The sound of a headset being removed can be heard as Candice throws Ryan back into the ring.)

Deadprez: What the hell is Kensingten doing?!

Eve: Kensingten has grabbed Candice and the two women are arguing! The referee has gotten out of the ring and he is trying to get between the two! Candice shoves Kensingten down and goes to get back into the ring, but Ryan Wilson is back to his feet now! He hobbles over and cuts Candice off, stomping on her shoulder! He pulls Candice up by the hair, but Candice is able to hit him with a forearm! Ryan nails her with a forearm and both of these competitors are exchanging shots with one another!

Gavin Kirkland: But look! My little Magnolia is up on the apron and she is screaming at Candice. Candice shoves Ryan back and whirls around, turning her attention to Kensingten! They argue some more and Candice snatches by Kensingten by the hair! She drags her into the ring and the referee is quick to break up the fight! Ryan! RYAN GRABS CANDICE AND ROLLS HER UP!

Deadprez: HE’S GOT THE TIGHTS AND KENSINGTEN SHOVES THE REFEREE AND SCREAMS AT HIM TO COUNT! THE REFEREE IS IN POSITION!

Eve: NOT THIS WAY! HE DOESN’T SEE RYAN HAS THE TIGHTS!

OOONNNEEE!!!

TTTTWWWWOOOO!!!!

TTTTTHHHHHRRRRREEEEEEEEEE!!!!!

(Ding! Ding! Ding!)

Gina Romano: LADIES AND GENTLEMEN… HERE IS YOUR WINNER AND OFFICIAL ENTRANT INTO THE KING OF ELITE TOURNAMENT… RYAN WILSON!

(Ryan’s music hits but his celebration is not what has the fans reacting.)

Gavin Kirkland: RUN MY LITTLE GEORGIA PEACH! HERE COMES CANDY!

Eve: CANDICE IS CHASING KENSINGTEN UP THE RAMP AND THEY HAVE DISAPPEARED TO THE BACK!

Deadprez: Kensingten just robbed Candice here tonight and oh shucky ducky. There’s gunna be Hell to pay inside the chamber for Miss Calhoun-Astor!

(Ryan Wilson doesn’t appear to be bothered by the fuckery at all. The animosity between Kensingten and Candice just allowed him to book a spot in the 2020 King of Elite tournament. The camera catches another shot of him celebrating his victory before fading elsewhere.)

(SCREEN BAR — EARLIER THIS WEEK.)

(Ahren Fournier is wearing one of his finest white fur coats. He waltzes into the local mall in Pawtucket, Rhode Island with Jennipurr in his arm, and a cappuccino in his hand. Chris Elite trails behind quite weary of the situation. Ahren is wearing an “ugly” Christmas sweater, which matches the one Jennipurr is wearing. They are here for one reason and one reason only.. for the yearly tradition of Jennipurr telling Santa what she wants for Christmas. Chris has no idea what they’re doing here, even though Ahren has told him a thousand times. Chris must have his mind on his money and his money on his mind a little too much.)

Chris Elite: Remind me what we’re doing here?

Ahren Fournier: I told you.. Every December, Jennipurr goes and tells Santa what she wants for Christmas.

Chris Elite: Damn Ahren, you treating that pussy right. How’d you find THE Santa roaming around these parts?

Ahren Fournier: Oh, a GOAT has his ways..

Chris Elite: I would never have suspected him being in a mall and shit.. seems a little lowbrow for him, ya know?

Ahren Fournier: I know what you mean.. look at all these disgusting creatures ( couple walk past Ahren, minding their own business). It’s like they don’t know what Versace even is.. like hello? Ever hear of even lower level Calvin Klein? Disgusting… Ew look at them…. Sweatpants? And, they’re not even designer? W.. T… F My brother.

Chris Elite: I feel that, I feel that..

(Three kids see Ahren and Chris and get excited. They run up to them with their phones out.)

Kid: ILLIONAIRES!! ILLIONAIRES CAN WE GET A PIC PLEASE?!!

Ahren Fournier: OMG AHHH!!!

(Ahren Fournier throws his cappuccino into the face of one of the kids as he screams as the beverage is piping hot, and pushes the other two down.)

Ahren Fournier: RUN!

(All of a sudden Ahren Fournier and Chris Elite start sprinting away from the situation until it feels like they’re a safe distance away.)

Chris Fournier: What the fuck was that? What happened?

Ahren Fournier: Children disgust me. They pretty much had it coming, tbh. How dare they come up to us with those grubby little fingers? They could’ve touched Jennipurr and made her impure… OMG! I’M HYPERVENTILATING AT THE THOUGHT!!! CALM ME DOWN, CHRISTOPHER!!

Chris Elite: Chill fam chill… It’ll be ok.. They won’t be bothering us anymore, we showed them who’s boss in this bitch. I’m pretty sure that one kid has third degree burns now.. scarred for life. That was good shit man.

Ahren Fournier: Well, I don’t want to be called a hero, but I most certainly am one.

Chris Elite: So where’s Santa man? I’m getting unnerved here…

Ahren Fournier: Fair enough…

(Ahren Fournier looks down from the third floor, and sees Santa Claus sitting at his throne. Ahren leans over the railing and screams.)

Ahren: SAAAAANNNNNTAAAAA!!! OH MY GOD!!!! ITS ME AHREN!! I BROUGHT JENNIPURR WE’LL BE RIGHT DOWN!!

(Ahren Fournier started sprinting to the nearest staircase forgetting that he came with Chris Elite in the first place. Running down the staircase as fast he can. Pushing everyone in his way out of his way, several of the people in his way are yelling at Ahren, but Ahren is focused on getting to Santa Claus.)

Chris Elite: Fuck that…

(Chris Elite goes to the elevator that they were standing next to and goes down meeting Ahren Fournier at the bottom. Meanwhile, Ahren makes it finally to the bottom floor, and sees Chris standing there waiting for him. Ahren huddles over out of breath.)

Ahren Fournier: How’d you do that?

Chris Elite: Elevator…

Ahren Fournier: What the hell is an Elevator? Forget it…

(Ahren Fournier looks at the line of kids waiting for Santa Claus; and a scowl comes over his face.)

Chris Elite: Bruh I ain’t waiting for that shit…

Ahren Fournier: Nor am I… Come along, Christopher.

(Ahren Fournier pushes through all the kids and adults escorting their kids. The adults and kids are yelling at Ahren for cutting them in line. Some of them had been waiting in line for hours and how dare this bih just cut in the front of the line?)

Ahren Fournier: Move, I’m famous!

(The people part like the red sea as Ahren Fournier makes his way to the front of the line. They’ve given up with yelling at The GOAT and just let him get to the front of the line. Santa Claus sees Ahren at the front of the line with Jennipurr. He gets confused because he didn’t see him for a few seconds ago.. but, understands who it is, so nothing really surprises him. It’s a yearly tradition, and he knows the deal.)

Ahren Fournier: SANTA! HI SANTA!! JENNIPURR IS HERE!!

Santa Claus: I’ll be right with you Ahren, and Jennipurr, just have to hear what little Timmy here wants for Christmas.

Chris Elite: MAN FUCK TIMMY! WHO DAT LIL BITCH EVER BEAT…

Ahren Fournier: My man has a point, Santa.

(Santa Claus sighs and complies with Ahren Fournier’s request.)

Santa Claus: Aight, you wanna Football?

Timmy: No… I …

Santa Claus: Ok, you’re getting a football. Get off my lap..

(An elf comes over and removes the kid from off his lap, as Ahren Fournier excitedly runs over to Santa Claus, and places Jennipurr on his lap.)

Ahren Fournier: Ok Santa, just so you know Jennipurr has been going through some stressful stuff, like being kidnapped.. or should I say CATNAPPED? So, she deserves all the presents. She might be a little shy this year because she doesn’t trust anyone anymore.. except me cuz I’m the GOAT.. And Chris cuz he is also GOAT.

Santa Claus: Oh, Jennipurr I’m sorry to hear that. Well, you look quite spiffy in your Christmas sweater!

Jennipurr: Meow..

Ahren Fournier: Santa, I’m wearing the same one!! Don’t we look cute?

Santa Claus: Of course! Well, what would you like for Christmas this year, Jennipurr?

Jennipurr: Meow.. Meow.. MEEOOOWWWW… meow… mew… MEOW…. Meow…. Meow… Meow.. MEEEOOOWWW.. Meow..

Santa Claus: That’s an awful lot of stuff!

Chris Elite: :skip: Santa, bruh. Ahren been said she been through traumatic shit.Fuck shouldn’t you know this shit already?

(Santa Claus ignores Chris Elite and keeps talking to Jennipurr. Chris leans over to Ahren Fournier.)

Chris Elite: Ay, I don’t think that’s the real Santa…

Ahren Fournier: Yeah… I know…

Chris Elite: FUCK WE DOIN HERE THEN?

Ahren Fournier: OMG RELAX! Jennipurr still believes.. ok? Everyone knows the real Santa only works in the Macy’s in New York.. but, she doesn’t.. and I’m not going to take away this joy from her. Also, it helps me find out what she wants for Christmas so..

Chris Elite: Aight Aight, that’s fair.

(Jennipurr jumps off of Santa Claus’ lap, and Ahren Fournier then runs over and hops on his lap.)

Chris Elite: Bruh.. Fuck is you doing?

Santa Claus: Ahren, you’re too big to sit on Santa’s lap.

Ahren: Look Santa, Christopher and I… we have a big match coming up.. Road to Redemption —

Chris Elite: — PAVEMENT TO RESTITUTION!

(Ahren Fournier and Santa Claus look at Chris Elite yell, but pay not much attention to it before the two of them focus on what Ahren is going to ask for.)

Ahren Fournier: We have a match going for the Tag Team Championships, and we really wanna win. I was wondering if you could sprinkle some Christmas magic and help us out a little bit?

Chris Elite: Oh shit he can do that? Ay bruh yeah do that shit..

Santa Claus: Of course…

(Chris Elite looks at Santa Claus, then looks at Ahren.)

Chris Elite: That’s it?

(Santa Claus takes out a bag, and blows dust into the eyes of Ahren Fournier and then Chris Elite.)

Chris Elite: FUCK!!! WHAT THE FUCK IM BLIND, BRUH!!

Ahren Fournier: Mmmm relax. It’s just the magic Christmas dust working it’s magic. THANKS, SANTA!!
(Ahren Fournier takes Chris Eliteby the arm, and Jennipurr into his other arm, and leads him away to the exit. Chris Elite is still trying to get the magical Christmas dust off his eyes.)

Chris Elite: I think some homeless dude just blew regular ass dust into our eyes.

Ahren Forunier: I mean.. Maybe, but Jennipurr had fun.

Chris Elite: I thought this was supposed to give us some sort of advantage going into Road to Redemption, bruh.

Ahren Fournier: HAHA!! Oh Christopher, do you really think we need anything to help us to have an advantage against Heavenly Hell??!

Chris Elite: HAHAHA!! Yeah, you right. Those Vampire bitches can’t even be in sunlight. How they gonna beat us?

Ahren Fournier: RIGHT?!! HAHAHAHAHA!!

Chris Elite: AHAHAHAHA.

Ahren Fournier: AHAHAHA!!! WE ARE LAUGHING HAHAHA SUCH GOOD TIMES. It’ll be such a Christmas wish come true to become Unified Tag Team Champions.. and Heavenly Hell? Per usual they will receive nothing on that blessed day except for coal! They hate Christmas, I’m sure. They don’t have fun with anything.

Chris Elite: First off, can we stop laughing like that? We don’t anyone to think we’re a couple of creeps. Second, yeah totally, because they’re miserable, and everyone hates them. Christmas bout spending time with yo loved ones, and ain’t no one love they bitch asses.

Ahren Fournier: Too true, too true. This bout to be the most GOAT Christmas EVER!

(The segment ends with Ahren Fournier and Chris Elite feeling optimsitc going into the match as they exit the mall and the scene fades to black.)

(Commercial for Google Stadia.)

(Camera returns to find Gina Romano inside the ring as the crowd eagerly awaits the next contest.)

Gina Romano: Ladies and gentlemen… the following contest is scheduled for…

Crowd: ONE FALL!

(“Odee” by A Boogie hits as Chris Elite, Ahren Fournier, Xander Payne, and Mark Michaels all step out onto the stage.)

Gina Romano: Introducing first! Making their way to the ring… the team of XANDER PAYNE! MARK MICHAELS! AND THE ILLIONAIRES!!

Deadprez: Illionaires looking to make a statement here tonight! Chris Elite already changed the tag team title match between the Illionaires and Heavenly Hell to a TLC match. And with a win tonight, they gain a lot of momentum going into Road to Redemption!

Eve: Chris Elite will have a big night as well as two of the men he’s teaming with here tonight are going to be his opponents inside the Extreme Elimination Chamber at Road to Red—

Gavin Kirkland: PAVEMENT TO RESTITUTION!!!!

Eve: oh my god… give it a fucking rest.

(The four men climb up alongside the ring as “Odee” is replaced by “Ultimate Battle” by ZENTA as Jamie O’Hara steps out followed by Cameron Ella Ava, Constance Blevins, and Minerva. Heavenly Hell both have their tag team titles around their waists.)

Gina Romano: And their opponents! Making their way to the ring, the team of… JAMIE O’HARA! CAMERON ELLA AVA! AND HEAVENLY HELL!

Eve: And here comes the rest of the equation. Aside from Mr. DEDEDE, all members of the Extreme Elimination Chamber are out here as well as the entire Tag Team Championship match! None of these competitors are unfamiliar with each other.

Deadprez: Right. Heavenly Hell have had recent matches with Cameron and Jamie, they’ve obviously been at odds with the Illionaires, and they even took the belts from Xander back when he was part of the Wildcards. Jamie and Cameron also have had recent run ins with the Illionaires as well as Xander Payne. And Mark Michaels, while until recently focused on the PURE title, has had his run ins with many in this match as well. We could be in for a long one! This is going to be a—

Eve: WHAT THE FUCK?!? WHAT JUST GOT ON MY LEG?!?

Gavin Kirkland: I… I’m sorry… it’s just… the sight of Jamie’s abs… mixed in with all these beautiful women… I… I couldn’t help it…

Eve: Did… did you really just… AND ON MY LEG?!?

Gavin Kirkland: IT WAS AN ACCIDENT!

Eve: You need to learn to focus! And stop getting so stuck in your disgusting sexual mind! If you spill your soda again I’m not buying you another one!

Gavin Kirkland: I understand.

Deadprez: Cum on, Gav. Get it together.

(Jamie and Cam slide into the ring as Heavenly Hell hand their titles to the officials before climbing up the steel steps. The referee preps both corners and calls for the bell.)

(DING! DING! DING!)

Eve: Looks like Cameron Ella Ava will start this match off against Chris Elite! Cameron starts to circle but pauses, not wanting to get caught in the enemy corner. Both meet in the middle for a lock up! Elite trying to use strength to drive Ava back but Cameron plants her feet back to hold her position! Cameron shifts her weight and turns Elite into a hip toss! Cam has Elite on the mat and holds him with a side headlock! Cameron now laying in fists to wear Chris down and keep him grounded! She tries to transition over, maybe looking for a choke? BUT ELITE TAKES THE CHANCE WITH A THUMB TO THE EYE!

Deadprez: Cameron is blinded for a moment and clutches at her eye but it’s all Chris needs! He kips up to his feet and connects with a roundhouse across the back of Cameron Ella Ava! Cameron’s body seizes for a moment with the hit to the spine and Elite drops in with a rear chin lock and a knee in the back! Elite pulling Cameron backwards and bending her backwards over his knee!

Gavin Kirkland: I’d love to have Cameron bent over my knee.

(Jamie O’Hara instinctively darts a look over at Gavin despite there being no possible way he heard that.)

Gavin Kirkland: I MEAN I HOPE SHE DEFEATS THAT SCOUNDREL! YARG! BUNNING SNAGS AND WHAT NOT!

(Jamie turns his head back to the action.)

Eve: Cameron is hurting but now turning through as she tries to find her escape! She reaches back and hooks Elite’s leg with her arm and rolls through! Cam escapes and rolls quickly to her feet! Elite getting himself up but Cam rushes in looking to gain the advantage— IN EXCELSIS!!!

Deadprez: BUT ELITE DODGES TO THE LEFT! Chris grabs Cam from behind! Back body drop plants Cam on her shoulder! Elite rolls over looking for a quick cover!

Ref: ONEEEEEEEEEEEEEE!

Deadprez: But Cam kicks out before even a two count! Elite shoves her back down to the mat and now looking to drop hammerfists into the goddess! BUT CAM CATCHES THE ARM! Cameron no slouch on the technical side of things in the ring! She rolls her legs through and wraps up Elite’s arm! Cameron locks in the arm bar! She has it applied and now wrenching back on Chris’s arm! She has that elbow joint hyperextended and Elite is feeling the pain!

Eve: Elite looking for the ropes but they won’t do him much good! These multi person tags have the same rules as multiman matches! No disqualifications! Elite realizing he isn’t going to make the ropes anyway has to find another escape! He tries to pry his arm free but it isn’t going anywhere! WAIT! ELITE ROLLS IN AND HAS CAM STACKED UP ON HER SHOULDERS!

Ref: ONE—

Deadprez: But Elite has no interest in a pin attempt he knows won’t get it done this time! He lifts up, getting his feet underneath him! He hoists Cameron up— AND SLAMS HER WITH A POWERBOMB! Cameron arches her spine and recoils from the impact! Elite looking for his chance to take advantage here! Cameron clutching at her back and Elite dashed to the side! He springboards you into the ropes! Backflips! BIONIC STOMP!

Eve: BUT CAMERON ROLLED OUT OF THE WAY! Elite lands and stumbles as he missed his mark! Cameron moves in— GODDESS TOUCH!

Gavin Kirkland: BUT ELITE DODGES TO THE SIDE AND CAMERON WHIFFS IT! Chris pops up and plants his foot— BOX OFFICE SMASH! CHRIS ELITE JUST NAILED CAMERON WITH THE SUPERKICK!

Deadprez: BUT IT KNOCKED CAMERON BACK INTO HER OWN CORNER! JAMIE O’HARA REACHES OUT AND TAGS HIMSELF IN! THE ACE IS THE LEGAL MAN! Minerva and Constance now pulling Cameron out to the apron as she recovers from the Box Office Smash! Jamie steps through the ropes and charges straight in! He takes Chris down with a clothesline and hops up! DOUBLE STOMP! Planting his boots right into the chest of Elite! Jamie now grabbing Elite up! Pulling him into position! JAMIE GONNA HIT THE STARDUST BREAKER!

**CLANG**

Eve: BUT AHREN FOURNIER FROM BEHIND WITH A STEEL CHAIR! HE JUST SAVED HIS TAG PARTNER! AND AHREN CHARGES JAMIE’S CORNER! HEAVENLY HELL BOTH DROP OFF THE APRON AND AVOID THE CHAIR! CAMERON IS STILL DOWN! THE CHANCE IS CLEAR AND CHRIS ELITE IS MOVING FOR HIS CORNER!

Deadprez: Elite is dragging himself over to try and tag out! He gets up to his feet and reaches out for Mark Michaels— BUT MARK JUST DROPPED OFF THE APRON!

Eve: Mark just dropped down to the floor and looks up at a confused Chris Elite. Mark has a grin on his face and… MARK IS LEAVING?!? Mark Michaels waving this match off and making his way up the ramp! He doesn’t care about tonight! He’s going to preserve himself for the chamber! Elite looks over to Xander! He goes to tag in— BUT XANDER DROPS OFF TOO! XANDER PAYNE DECIDING TO FOLLOW IN MARK’S STEPS!

Xander Payne (off mic): This match is a waste of time!

Deadprez: Xander was clear all week about how he felt regarding this tag match! And now he’s letting that be shown here tonight! Xander making his way up the ramp as well! Mark has already disappeared through the curtain! Chris turns back and Ahren is still standing over Jamie! He looks back and knows what he has to do! Ahren drops the chair and runs to the corner! Both men clasp hands! Ahren is tagged in!

Gavin Kirkland: BUT LOOK! THEY KEEP THEIR HANDS CLASPED FOR A MOMENT! THEY LOOK INTO EACH OTHERS EYES IN A TOTALLY MANLY AND HETEROSEXUAL WAY! BY THE POWER OF BEST FRIENDSHIP! THE ILLIONAIRES WILL OVERCOME TOGETHER!

Eve: BUT MINERVA FROM BEHIND! SHE BASHES FOURNIER IN THE BACK WITH A LADDER! AHREN AND CHRIS’S HEADS COLLIDE! CHRIS DROPS TO THE MAT CLUTCHING AT HIS FACE! AND CONSTANCE IS IN NOW! SHE PULLS AHREN IN THROUGH THE ROPES! DRAPING DDT PLANTS THE GOAT!

Deadprez: Minerva sliding that ladder into the ring now! She lifts the ring apron up! And now pulling out a table! Minerva has a wood table out and pushes it into the ring as well! Well, they did make it a TLC match next week!

Eve: Chris Elite trying to push himself back up but Constance has that chair now! And she beats it into Chris while Minerva begins to set up the table! Blevins bashing the chair into Chris! OH! AND SHE DENTS IT OVER HIS HEAD! Constance now tossing the chair aside! Minerva has the table set up and moves on to stand the ladder on its feet! Cameron is awake now and looks absolutely perplexed by what’s happened! Constance rolls Ahren onto the table! She looks back at Minerva who finishes setting up the ladder! Both women nod at each other! The tag team champions climbing up the ladder now! Both of them! One on each side!

Gavin Kirkland: THATS FOUR WHOLE TITTIES FOR JUST ONE LADDER!

Deadprez: That’s right Gavin. You get a gold star for math.

Gavin Kirkland: :blessed:

Eve: Both women up to the top now! Minerva steps around to Constance’s side… AND BOTH WOMEN DIVE TOGETHER! DOUBLE ELBOW DROP FROM OFF A LADDER DRIVES FOURNIER THROUGH THE TABLE HE WAS ON! HE’S LAYING DEAD IN A PILE OF DEBRIS! AND ELITE STILL ISN’T MOVING!

Deadprez: Constance and Minerva now sliding out of the ring! They’re walking this way! They reach out to the timekeeper and take their tag team title belts and hold them up! Wait! Now they’re stepping up onto the commentary desk?!? They’re holding the titles high over the beaten down Illionaires! Chris has barely opened his eyes to see them standing there and—

Eve: GENKI CANNON!!! JAMIE JUST HIT THE DIVING DOUBLE FOOT STOMP FROM THE TOP OF THE LADDER ONTO FOURNIER! HE DROPS DOWN FOR THE COVER!

Ref: ONEEEEEEEEEEEEEE!

TWOOOOOOOOOOOOOOO!

THREEEEEEEEEEEEEEEEE!

(DING! DING! DING!)

Gina Romano: HERE ARE YOUR WINNERS… HEAVENLY HELL, CAMERON ELLA AVA, AND JAMIE O’HARA!!

(“Ultimate Battle” hits again as Jamie has his hand raised. Cameron joins him in the ring, shaking her head at the chaos around her. Jamie simply shrugs.)

Deadprez: Damn! I almost forgot Jamie was the legal man! He saw an opening and took it! The Ace gets the win!

Gavin Kirkland: His abs helped too!

Eve: Well Jamie and Cameron pick up some important momentum heading into the chamber next week! And Heavenly Hell made their statement here against the Illionaires! They don’t care about a Gawd Contract! They’re the champs for a reason!

Deadprez: Road to Redemption is shaping up to be quite the night!

(Final shot shows Jamie and Cameron chucking on each other as Chris is pulling Ahren out of the ring. Minerva and Constance are still standing on the commentary desk, holding their titles high and watching the Illionaires slink away.)

(Commercial for Star Wars: The Rise of Skywalker, featuring Scott Diamond.)

( Showdown returns from commercial break. The Elimination Chamber is seen lowered around the ring, engulfing the ringside area with its imposing size. The lights seem to dance, and an ominous hum can be heard across the sound system while the fans in the sold out Canadian Tire Centre buzz in sheer excitement. Despite the shenanigans of the EAW Chairman, and the unconventional names scheduled to participate in this match, they are still in awe of the mere presence of the Extreme Elimination Chamber. When it finishes lowering to engulf the ringside area, Gina Romano stands up from her seat with the microphone in hand. )

( DING! DING! DING! )

Gina Romano: The following is an EXTREME ELIMINATION CHAMBER MATCH!!!! This match begins with two combatants in the ring and four other competitors enclosed in their respective pods! At various intervals a pod door will open, allowing another combatant to compete. This process will continue until all pods are empty! If at any time a participant is pinned or submits, he is ELIMINATED and must exit the chamber! The last person to remain will be declared the ANSWERS WORLD CHAMPION!!!!!!!!!!!

( “Let It Go” by A$AP Ferg hits, and the crowd becomes unglued and give DDD a loud mixed reaction. The fans pour their all into either booing or cheering him, depending on each individual’s personal opinion on him. Mr. DEDEDE strolls out to the stage side by side with his arranged wife Kassidy Heart, locking hands with her. DEDEDE is dressed in the unreleased Gawdzilla Pro Black Mass tracksuit over his ring gear, and with the Answers World Championship around his waist. DDD looks around at the audience first, and then beholds the Elimination Chamber structure – pretending to treat it with the seriousness it deserves. DDD turns to Kassidy and two exchange a passionate kiss before he sends her backstage, and continues his walk to the ring. )

Gina Romano: Introducing first, residing in Santo Domingo, Dominican Republic weighing in at 227 POUNDS!!!! HE IS THE REIGNING!!!! DEFENDING!!!! ANSWERS CHAMPION OF THE WOOOOOOOOOOOOORLLLLDD!!!! MMMMMMISSTTTEEEEEEEEEEEEEEERRRRRRR DEEEEEEEEEE DEEEEEEEEEEEEEEEEEEEE DEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE!!!!!

Gavin Kirkland: What a way to end the last Saturday Night Showdown of 2019, and for the love of Gawd what a sight to behold!!!! I can’t believe how dedicated and driven our Answers World Champion is – the man just wrapped up a North American Gawdverbs LIVE! tour for crying out loud, and now he’s here to entertain the EAW Universe like only he knows how! He is the immortal Gawdzilla, he may be a champion for the record books, but you can tell by the passion in which he locked lips with his golden goddess of a wife that that sealed kiss may be a potential kiss goodbye! Even HE knows that he may be entering the most difficult title defense of his illustrious career!

Eve: You’re talking about RTR right….

Gavin Kirkland: What are you dumb or are you deaf?! I’M TALKING ABOUT TONIGHT EVE! DO YOU NOT SEE THE EXTREME ELIMINATION CHAMBER RIGHT HERE IN FRONT OF YOUR FACE?!

Eve: You’re not actually buying this, right? Did you see some of the names that are supposedly supposed to join him in this “title defense”?

Gavin Kirkland: Oh we all saw them, and if the turnout is even HALF as demonstrative as advertised we’re in for a fucking blood bath! We’re looking at six of the baddest human beings on the planet, but we are a monotheistic wrestling federation Eve, there is only one Gawd and one Gawd only, and that man is in the ring right now with a microphone in hand and something on his mind!

Eve: I was going to respond to your dramatizations but you know what I’ll just leave it alone. Let’s take it up to the ring where our Chairman and Answers World Champion has the floor.

( Mr. DEDEDE is in the ring with a microphone, and he waits for the audience to settle down the raucous before he begins speaking. )

Mr. DEDEDE: As promised, I made good on what I said I would do. I went the extra mile, I took the necessary steps to make good on my assurance to all of you people. I took the red eye Thursday night out of Honolulu fresh off my Gawdverbs LIVE! HBO taping down at the BYU Hawaii campus, landed in New Jersey Friday and seized the day as only a Gawd knows how. Effectively made the bankrupt cucks over at Mattel kneel and grovel before me, (turns to the dressing room) and secure more guaranteed merchandise money for this ungrateful ass roster for the next FIVE YEARS. “THANK YOU GAWD!” YOU’RE VERY WELCOME PEASANTS. And now I’m here.

Although in all honesty, from the moment I got out of my private charter and stepped foot in this city and saw all of your cold, pale ugly faces I instantly regretted it. If you want to know what the most neutered country on the planet is, look no further than goddamn Canada.

( Crowd boos. )

Mr. DEDEDE: Why do you think I didn’t even bother putting a single date of my sold out successful Gawdverbs LIVE! tour in this country? Canadians are far, far, far too mindless to make use of the message in my prophetic doctrine. Can you imagine me at the University of Toronto delivering the same messages of promoting power, wealth and influence and building self mastery in the sublime form and fashion in which I did before the students down in the University of Arizona? Or Spelman? Or even UT? Yeah, nah. Stick to what you know best, geeks. Canadians are only good for three things in this world, (1) Hockey, (2) Wrestling (3) watching another man have sex with their wife.

( The crowd unleashes hell in the form of boos upon DDD. )

Gavin Kirkland: DON’T FORGET BEASTIALITY!

Mr. DEDEDE: I want to make something very clear to all of you. I don’t cut wrestling promos. I don’t compete in wrestling matches. I am not a wrestler. I exist as any celestial being exists. I exist relative to your proximity to me. OK I know that sailed right over your thick fucking Mountie hats, so let me rephrase that to suit your level of comprehension. I am a winner whether you are burned by the glow of the lights my name is draped in, or whether my name serves as the only source of light in the dark. I am on this earth to succeed on any and every platform that suits me. That’s what competent people with high IQs and great genetics do. It just so happens that I am a gladiator in the modern era. I am a general, a savant at war before anything else. The only reason why I’m standing in this ring right now and carrying the Answers World Championship and not prizefighting somewhere else, is because the artform of wrestling suits me. It allows me to be the unmitigated, undisputed god of war that I’ve been for the last 15 years now without the unnecessary rules and red tape. Make no mistake about it, I am not here for your entertainment. I am not an entertainer. You are here to observe greatness in the same way you observe the stars above. And don’t you ever forget: I am the star above you. I am the leading light whose examples you’d be hard pressed not to live by. I am the muse to many a great man, and amusement to foolish and lowly piles of garbage like so many of the people sitting here in this scrap heap for an arena.

So here I am in all my glory, entering my fifth Elimination Chamber, prepared to step up to the plate yet again. I submit to you that I am in the middle of the greatest Answers World Championship reign you have ever seen. I don’t care how long Theron dragged the title around, or how many times Ares Vendetta statpadded his reign, or how overrated Norman Hellion and Hades were as champions. My reign overshadows all of theirs combined. I have had a perfect season as champion. PERFECT. Not one pinfall, not one submission, no disqualifications, not one loss of any form. “BUT GAAAWD!” Yes you insufferable shit for brains mongoloid, “BUT W-W-W-HY YOU DUCKING HARLOW FORE?!” Because you dumb son of a dog, competing with her accomplishes less than nothing for me. That applies to the majority of the EAW roster, which is why I’m not competing against them, either. The five other chumps in the Road to Redemption Chamber should be happy I’m so much as willing to walk into the city of Toronto next weekend let alone challenge me for my title. There’s no reason why that human/warthog hybrid Xander Payne should even be allowed to breathe the same air as me. Don’t get me started on the rest.

Tonight however I have invited some of the most nefarious, some of the most dastardly, imposing, destructive forces in modern history. These people are sick, they’re twisted, they’re ruthless, as callous as they are cunning. They’re evil sons of Bitches who prey on women and children for sport. Something I absolutely never would do in a million years. I’m a champion not just to wrasslin fans, but I am a World Champion in every sense of the word. I am the champion mankind can believe in, and I am going to take great pleasure in putting these evil men in their place. I will line them up, one by one, and stomp them out of existence with my jolly green giant sized boot. And ain’t nothing jovial about what’s getting ready to go down. So without any further delay, let’s bring out the remaining five participants for tonight’s Extreme Elimination Chamber!!!!

….

( “Nickelodeon Girls” by Pink Guy plays over the sound system, and Clark Duncan walks out with his Parole Officer following closely behind him. Gina Romano stands up from her seat to announce the entrants, but DDD quickly turns to her to call her off. )

Mr. DEDEDE: Sit down bitch I’ll take this from here. (clears throat) Introducing the first challenger… hailing from his safe space in the DMs of 15 year old girls, he is the founding father of EAW’s kid diddling revolution! CLARK DUNCAN!!!!!

Eve: ……….

( Clark Duncan is seen writing his phone number on a note and slipping it to a 12 year old girl in the audience before mouthing the words “call me” with a wink. Clark’s PO drags him away from the girl and forces him into the chamber as quickly as possible. Clark Duncan’s PO hands him the police baton to use as a weapon. )

Gavin Kirkland: A former EAW New Breed Champion! A participant in the Extreme Enigma Memorial Elimination Match back at Pain for Pride 8, just if you’re wondering why EAW did away with that match to begin with! He is one of the revolutionaries behind the echo chamber culture that permeated EAW’s previous culture, and now he’s returned at long last! I missed him so much :mjcry:

( Convicts – “Whoop Her Ass” plays. A scrawny grunge white boy with messy hair wearing a wifebeater walks out with a scowl and manic look on his face. He turns back and screams at the top of his lungs, and his scared battered girlfriend walks out with a visible black eye holding a small box containing a cake inside of it under one arm, and holding an infant child in her other arm. They walk to the ring together while the white boy continues to verbally abuse her. )

Mr. DEDEDE: Next up, accompanied by Stockholm Sunflower, from Bunker Hill, Illinois weighing in at a two-piece combo with a biscuit, AXL TURNER!!!!!!

Deadprez: :mjlol:!!!!

Eve: For the love of God.

Deadprez: What do we know about Axl Turner Gavin?

Gavin Kirkland: Not much to be quite honest with you DP! He hasn’t accomplished shit in professional wrestling or outside of it, but he does have one caveat going for him, he is a prodigious STRIKER! The hand speed, the motion, the form, the quickness, the accuracy in which he is able to knock a bitch out is truly astounding! Some of the best we’ve ever seen in the business! Combine the pure aggression of Chris Brown with consistency of Ike Turner and you get Axl Willow-I mean Turner.

Eve: Can someone tell this Stockholm Sunflower person not to bring a child into an Elimination Chamber for Christs sakes? What the hell is even happening here?

( Idina Menzel & Michael Bublé – “Baby It’s Cold Outside” plays and Finnegan Rapefield walks out dressed in a thumb costume, looking forward to sweet blissful death. )

Mr. DEDEDE: Hide your sisters! Hide your daughters! Our next challenger, weighing in at approximately two thumbs up, hailing from the Ohio Valley, he is FINNEGAN RAPEFIELD!!!!!

Gavin Kirkland: Another former New Breed Champion! There must be something fucked with that title in general, maybe we should keep our eyes on that Jamie O’Hara guy, he was a New Breed Champion too before you know!

Eve: Don’t you dare invoke Jamie’s name into this nonsense.

Gavin Kirkland: Rapefield has done well for himself despite his personal life transgressions. He’s even managed to quell the heated blood feud between Impact and Tomi Venus! Something previously believed to be only possible through divine intervention!

( Scott Gairdner – “Sex Offer Shuffle” plays, and a tall gray haired man who bears a striking resemblance to Jeffrey Epstein walks out to the stage, dressed in an orange jumpsuit with a noose tied around his neck. )

Mr. DEDEDE: Our next entrant! From the Metropolitan Correctional Center in New York City, he is the GHOST OF JEFFREY EPSTEIN!!!!

Gavin Kirkland: This may be my sleeper pick to win the entire Elimination Chamber!

Eve: Dare I ask, how do you figure?…

Gavin Kirkland: He’s the only person in history who’s managed to be on the Clinton Kill List and live to tell the tale! Seth Rich could never. I stan a true GOAT!

Deadprez: What the hell is a Clinton Kill List, and who the hell is Seth Rich?

Eve: Nevermind him he’s just spouting off far right conspiracy theorist rhetoric. Besides the real Epstein was best buddies with the troll in office too and probably had more dirt on him than anybody. Either way I think it’s safe to say he has the lowest chance at surviving in this so-called “match”, he looks like he weighs 100 pounds soaking wet!

( Epstein’s ghost pulls out a pen from his jumpsuit and approaches the same 12 year old girl who was hit on by Clark Duncan. He takes the note from her hand and adds his phone number to the note before handing it back to her. Once he enters the ring he joins, DDD, Rapefield, Duncan, Axl Turner and Stockholm Sunflower. The inhabitants of the ring await the final entrant. )

( The lights go out. )

( “You Are My Sunshine” by Alone plays creating a haunting atmosphere in the arena. )

“The other night, dear
As I lay sleeping
I dreamed I held you in my arms
When I awoke, dear
I was mistaken
And I hung my head and cried”

Gavin Kirkland: Hold me, Eve.

Eve: No.

( “The Fiend” Eclipse Diemos emerges out from the darkness onto the stage, wearing a terrifying mask and holding a lamp figurine to brighten his path. )

“You are my sunshine
My only sunshine
You make me happy
When skies are grey
You’ll never know, dear
How much I love you
Please don’t take my sunshine away”

( The music cuts off. )

( R. Kelly – Ignition (remix) hits in its place, and “The Fiend” Eclipse Diemos does a dance routine on his way to the ring accompanied by an individual dressed in a schoolgirl outfit with a very apparent phallic shaped object poking through their miniskirt. )

Mr. DEDEDE: Last but certainly not least! Accompanied by Sandra Bullcock, residing in a side server near you by way of the nearest long pig buffet, “THE FIEND” ECLIPSE DIEMOS!!!!

Gavin Kirkland: PERHAPS THE MOST ACCOMPLISHED OF THE OPPOSITION FACING OUR CHAIRMAN! A FORMER KING OF ELITE, A FORMER WORLD CHAMPION, A CULTURAL PILLAR AND AN ICON! HOW CAN YOU EVER KNOCK THE HUSTLE? THINK OF WHERE WE’D BE IF NOT FOR THIS HONORABLE MAN! AND HE’S STILL AS MUCH OF A LADIES MAN AS EVER! SANDRA BULLCOCK IS LOOKING LOVELY THIS EVENING, ISN’T SHE DP?!

Deadprez: Not sure that’s what I’d consider a “lady”..

Gavin Kirkland: WELL YOU’D BETTER, DP! IT’S 2019 AFTER ALL! YOU WOULDN’T WANT TO BECOME THE NEXT VICTIM TO CANCEL CULTURE WOULD YOU? YOU CALL THAT PRE-OP LINEBACKER LOOKING MUTHAFUCKA IN A DRESS A WOMAN RIGHT NOW, AT THIS INSTANT!

( Eclipse and Bullcock join DDD in the chamber. The referee stands in the center of the chamber participants looking flabbergasted for a second at the freakshow surrounding him. )

Eve: That poor ref has no idea what to make of any of this. DDD is the first to voluntarily enter his Elimination Chamber pod, which I suppose shouldn’t come as any shock. Entering the chamber as well is Rapefield, Epstein’s Ghost… I can’t do it. I can’t call this match. This is a complete joke.

Gavin Kirkland: NEVER FEAR I’LL TAKE IT FROM HERE! EPSTEIN, RAPEFIELD, NIGEY AND THE GAWD HAVE ALL TAKEN THEIR CHAMBER PODS! LEAVING THE EAW VIXEN NUDES FIEND AND AXL BROWN IN THE RING WITH THEIR DOMESTIC “PARTNERS”!

( DING! DING! DING! )

Gavin Kirkland: AND AWAY WE GO! FOR THE 2ND TIME IN HISTORY AN EXTREME ELIMINATION CHAMBER TAKES PLACE ON SHOWDOWN, AND THE STAKES COULDN’T BE ANY HIGHER! The Fiend Eclipse and Axl Brown are ready to come to blows here, the Answers World Championship is up for grabs, one of these men may walk into Road to Redemption holding the most illustrious prize in our great sport!

Deadprez: Hold on, now. I think that Stockholm Sunflower girl has got something to say.

( Stockholm Sunflower sets the cake down, and she picks up the microphone that DDD left on the floor while cradling her baby under one arm. She turns to her abusive boyfriend, trembling, ready to get something off her chest. )

Stockholm Sunflower: Axl baby. You know I have your back always and forever, I hope you know that. But there’s something I’ve been meaning to tell you.

( Axl Turner looks confused. )

Stockholm Sunflower: So I’m sure you remember three months ago when we took our baby boy Cayden to do a DNA test, since you wanted to make sure that you were the father. And when the doctor gave me the results I- well, I told you that the baby was yours. …. I lied.

Gavin Kirkland: :damn: !!!!!!

Eve & Deadprez: :lupe:

Axl Turner: ….

Stockholm Sunflower: (fighting back tears) I’m sorry. I’m so sorry. But Cayden isn’t your child. I wanted to tell you, I just didn’t have the strength-

( Axl Turner gets in her face. )

Axl Turner: WHO’S FUCKING BABY IS IT THEN!!!!!!!??!??!?!?!?!??!?!?!?!?

( Axl’s screams are so loud that it startles the infant child, and baby Cayden begins crying. )

Stockholm Sunflower: It’s his.

( Axl Turner turns around, as Stockholm Sunflower is pointing to… )

“The Fiend” Eclipse Diemos: :eclipse:

Gavin Kirkland: OH MY GOODNESS! STOCKHOLM SUNFLOWER HAS COMMITTED THE ULTIMATE BETRAYAL! BILLIE JEAN IS NOT AXL’S LOVER, AND IN THE CASE OF CAYDEN TURNER, THE KID IS NOT HIS SON! CAN YOU IMAGINE WHAT MUST BE GOING THROUGH AXL’S MIND RIGHT NOW?!

( Stockholm Sunflower hands the child to Fiend Eclipse, who greedily grabs the boy and cradles him in his arms. )

Gavin Kirkland: FATHER AND SON UNITED AT LAST! DID YOU HEAR THAT? CAYDEN IS CALLING HIM DADA! THOSE MIGHT HAVE BEEN HIS FIRST WORDS! IT’S A CHRISTMAS MIRACLE!

Deadprez: Axl Turner goes from looking visibly distraught to utterly apoplectic. This Sunflower girl had better run :lupe: !!!

Gavin Kirkland: IKE WILLOW CHARGES AFTER ECLIPSE KELLY!

( The lights go out. )

( The lights turn back on. Sandra Bullcock and Fiend Eclipse are nowhere to be found, and they’ve taken the infant child with them. This leaves Axl Turner in the ring to look around frantically. Stockholm Sunflower lightly tugs at Axl’s arm to get his attention, and Axl swiftly turns around seeing nothing but red before – )

Gavin Kirkland: HAYMAKEEEEEEEEEERRRRRRRRRRRRRRR!!!! WHAP! BOOM! BAM! UPPERCUT, CROSS AND A SILENCING FINISH! POW! AXL BROWN HAS JUST PUT STOCKHOLM SUNSHINE’S DOWN LIKE A DOG! AXL IS STOMPING HIS OWN BITCH OUT, WHILE ECLIPSE KELLY IS NOWHERE IN SIGHT! WHATEVER DARK RECESSES OF HELL HE’S GONE TO, ONE THING IS CERTAIN, HE IS GIVING THAT UNSUSPECTING INFANT CHILD ‘THE BUSINESS’ AND HE’S DOING IT LONG PIG STYLE!!!

Eve: I-

Gavin Kirkland: THIS CROWD IS DISGUSTED AT THE BEATING AXL TURNER HAS UNLEASHED! BUT HE’D BETTER REFOCUS HIS AGGRESSION BECAUSE SOMEONE WHO CAN ACTUALLY DEFEND THEMSELVES IS DUE TO ENTER THE ELIMINATION CHAMBER ANY MINUTE NOW!

( CLOCK: 10…9…8…7..6…5…4..3..2…1.. BUZZ!!!! )

( The lights dance between each chamber pod, determining at random who will enter the match next. The light stops on the chamber of… MR. DEDEDE! )

Gavin Kirkland: IN COMES THE GAWD! AXL TURNER IS IN THE MIDDLE OF STOMPING HIS GIRL OUT, AND MR. DEDEDE EXITS THE CHAMBER!

( Axl Turner takes a pause from stomping his girlfriend out to lock eyes with Mr. DEDEDE. DEDEDE watches the display of domestic violence, and instead of stepping into the ring, he nonchalauntly shrugs his shoulders, telling Axl to “carry on” before re-entering his own pod. )

Gavin Kirkland: LOOKS LIKE AXXXTENTATCION IS FREE TO UNLEASH MORE HELL ON HIS GIRLFRIEND, THE GAWD ISN’T GONNA INTERVENE! Axl lifts up his girl from the floor, and she jumps out of his arms and scrambles to the corner cowering in fear! Axl corners the poor woman and starts slamming punches over her head while she can barely cover herself up and defend herself!

Deadprez: Well because DDD declined to enter the match, another pod opens in his place, and that is the pod of the alleged ghost of Jeffrey Epstein.

Gavin Kirkland: Axl is far too focused on showing his bitch who’s boss! He’s jamming his thumbs into her eyes and is screaming in her face while she loudly weeps!

Axl Turner: YOU WANNA EMBARRASS ME?!?! IN FRONT OF THE WHOLE WORLD, YOU WANNA HUMILIATE ME?!?!

Gavin Kirkland: FROM BEHIND THE GHOST OF JEFFREY EPSTEIN CATCHES AXL WITH A SCHOOL BOY ROLL UP! HE WOULD KNOW A LOT ABOUT ROLLING UP ON SCHOOL GIRLS!

Ref: OOOOOOOOOOOOOOOOONE!!! TWO!

Gavin Kirkland: AND SAVANNAH – I MEAN STOCKHOLM BREAKS UP THE PIN!

Eve: Is she serious???

Gavin Kirkland: YOU’VE GOT TO ADMIRE THE LOYALTY THAT SUNFLOWER HAS FOR HER MAN! EVEN AFTER JUST HAVING THE CRAP KICKED OUT OF HER, SHE IS WILLING TO FIGHT FOR WHO SHE LOVES! SOME MAY CALL IT BATTERED WIFE SYNDROME, I CALL IT BEING A SHINING EXAMPLE FOR ALL OTHER WOMEN TO FOLLOW! Epstein stands up, and looks at Stockholm Sunflower up and down from head to toe.

Ghost of Epstein: If only you were 10 years young.

Stockholm Sunflower: Don’t you mean 10 years younger*?

Ghost of Epstein: I said what I said :mjgrin:

Gavin Kirkland: AXL TURNER FLOORS THE GHOST OF EPSTEIN WITH THE IKE TURNER SPECIAL!!! A NOD TO VISUAL PROPHET! AND NOW HE COVERS EPSTEIN WITH A LATERAL PRESS!

Ref: OOOOOOOOOOOOOOONEEEE!!! TWOOOOOOOOOOOOOOOOOOOOOOO!!!

Gavin Kirkland: HE’S ALIVE!

Deadprez: Well, as alive as you can be for a ghost.

Gavin Kirkland: Axl Turner is fuming! He’s got anger issues, that much is apparent! He’s tugging at his curly mop-like hair and is hyperventilating! He seems to be seeing red and only red! And now his battered girlfriend Stockholm Sunflower pulls Epstein up from the floor and into his arms.. for a GERMAN SUPLEX!!! NO WAIT EPSTEIN MANAGES TO ESCAPE, AND TAKES AXL TURNER DOWN WITH THE SITOUT FACEBUSTER! HE CALLS THAT THE “EPSTEIN’S ISLAND!” HOOK OF A LEG!

Ref: OOOOOOOOOOOOOOONEEEE!!! TWOOOOOOOOOOOOOOOOOOOOOOO!!!

Gavin Kirkland: SUNFLOWER STOPS THE REFEREE FROM COUNTING! The official is taking great issue with her interference, but Stockholm Sunflower is defying the term “these hoes ain’t loyal!” She wants nothing more than to make it up to her man!

( CLOCK: 10…9…8…7..6…5…4..3..2…1.. BUZZ!!!! )

( The lights dance between each chamber pod, determining at random who will enter the match next. The light stops on the chamber of… FINNEGAN RAPEFIELD! )

( Finnegan Rapefield exits his chamber, drops to one knee and cups his hands over his mouth CM Banks style to yell out the words: )

Finnegan Rapefield: IT’S RAPIN’ TIME!!!!

Eve: Oh brother.

Gavin Kirkland: RAPEFIELD’S ON THE LOOSE!!! WE’RE TALKING ABOUT A FORMER CHAMPION IN HIS OWN RIGHT! RAPEFIELD JUMPS INTO THE RING! EPSTEIN COMES RIGHT AFTER HIM! SAMOAN SPIKE FROM RAPEFIELD TAKES EPSTEIN DOWN! RIGHT TO THE WINDPIPE! RAPEFIELD TARGETING AN INJURED AREA!

Eve: .

Gavin Kirkland: STOCKHOLM SUNFLOWER CHARGES HIS WAY! SAMOAN SPIKE TO STOCKHOLM SUNFLOWER! AXL MAYWEATHER WITH A SOUTHPAW LEFT HOOK! BUT FINNEGAN RAPEFIELD DUCKS UNDER IT, AND DELIVERS A THUMBS UP STRAIGHT INTO THE GROIN! THAT’S IT, I’M CHANGING MY PICK, I’M PICKING RAPEFIELD FOR THE WIN!

Deadprez: Finnegan pulls Axl Turner off the floor and flings him over the ropes so that he’s now at ringside. Axl Turner is using the chamber pod where Clark Duncan is in to lean against and recover…

Gavin Kirkland: OH MY GOD!!!!!!!!! LOOK OUT!!!!!!!!!! RUNNING SPEAR FROM RAPEFIELD!!!!! TO SEND AXL CRASHING THROUGH THE POD!!!!

( Axl Turner jumps out of the way at the last second. )

Gavin Kirkland: THE TOP PORTION OF RAPEFIELD’S THUMB COSTUME CRASHES THROUGH THE CHAMBER POD, NARROWLY KILLING CLARK DUNCAN!!!

Eve: What in the world? How hard is that costume anyways?!

Gavin Kirkland: HARDER THAN THE THUMB LOOKING CHODE BETWEEN HIS LEGS THAT HE TAKES PHOTOS OF TO DM OUR FEMALE TALENT! Nevertheless! Rapefield is shaken up by that crash, but Clark Duncan is using the opportunity created in order to exit his chamber pod and enter the match! Clark Duncan enters the ring, looking for the next person to attack! He spots Jeffrey Epstein’s ghost! AND IS GOING TO STRIKE HIM WITH THE POLICE BATON! NOT SO FAST!!! EPSTEIN CATCHES HIM COMING AND TAKES HIM DOWN WITH THE “EPSTEINS ISLAND”!!! THERE’S A COVER!

Ref: OOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEEEEE!!

Gina Romano: Clark Duncan has been eliminated!

Gavin Kirkland: Well you never like to see Pedophile on Pedophile violence :mjcry: Why can’t we all just get along?

Eve: Well, he still lasted longer in this match than he did as a main eventer in EAW.

Gavin Kirkland: Sheck Willow is back in the fold right now and he sends Finnegan Rapefield flying with a German Suplex! My new favorite pick to win this match showing ruthless aggression right now! Here he comes, grabbing Epstein from behind and sending him flying with a German suplex! AND NOW AXL GRABS HIS OWN BITCH, STOCKHOLM SUNSHINE, AND HITS HER WITH A GERMAN SUPLEX! AXL RUNS UP TO THE TOP TURNBUCKLE NOW, WASTING LITTLE TIME! HE LEAPS OFF!!! DIVING HEADBUTT!!!!!!! AXL BENOIT RIPS HIS WIFEBEATER OFF AND IS FOAMING AT THE MOUTH LIKE A RABID WOLVERINE, HE IS READY TO GO FOR THE JUGULAR! CRIPPLER CROSSFACE!!! STOCKHOLM SUNSHINE TAPPING OUT INSTANTLY! BUT AXL REFUSES TO LET GO!

( The lights go out again. )

( The lights come back on, and Fiend Eclipse has returned to the ring next to Sandra Bullcock. )

Gavin Kirkland: HOLY SHIT! ECLIPSE IS BACK! BACK FROM THE PREPUBESCENT PLAYPEN IN THE DUNGEON OF THE PRESCOTT HILLS SANATORIUM! AND HE’S RETURNED WITH SANDRA’S FULLBLOWN BULLCOCK IN HIS HANDS! HE’S RIDING IT LIKE A PONY! AND HE JABS THE POINTY END OF IT IN AXL’S EYE! FIEND ECLIPSE TURNS TO EPSTEIN! WHAM!!!! HE RAMS HIS BULLCOCK STRAIGHT INTO EPSTEIN’S ASS! EPSTEIN SQUEALS IN A SIMILAR FASHION TO HOW HE AND PRINCE ANDREW MADE LITTLE GIRLS SQUEAL IN THE UNDERGROUND LAIRS OF HIS VIRGINITY-TAKING ISLAND IN THE VIRGIN ISLANDS! THAT’S IT FIEND ECLIPSE IS MY NEW FAVORITE PICK!

( CLOCK: 10…9…8…7..6…5…4..3..2…1.. BUZZ!!!! )

( The lights dance between each chamber pod, determining at random who will enter the match next. The light stops on the chamber of… MR. DEDEDE! Mr. DEDEDE rips off his Gawdzilla Pro tracksuit and enters the fold, dressed to compete. )

Gavin Kirkland: I SPOKE TOO SOON! GAWD IS HERE! GAWD IS IN THIS! MR. DEDEDE ENTERS THE RING LOOKING TO EARN HIS FOURTH VICTORY IN AN EXTREME ELIMINATION CHAMBER MATCH, WHICH WOULD BE AN UNPRECEDENTED FEAT IN THIS COMPANY’S HISTORY!

Eve: I’ve never been more happy to see DDD in my life. Which speaks volumes considering I actually dated the man once. Perhaps he can put this to a merciful end. And yes if you’re just tuning in, no need to adjust your television set. You are watching Mr. DEDEDE having a staredown in the ring with “The Fiend” Eclipse Diemos in 2019.

Gavin Kirkland: THE GAWD TAKES OFF!!!! SPEAR!!!!!!!

… NO!!! HE’S HIT OVER THE HEAD WITH ECLIPSE’S BULLCOCK! GAWD GOES DOWN! GAWD GOES DOWN! OUT OF DESPERATION OUR FEARLESS LEADER SCRAMBLES BACK UP! AND HE’S HIT OVER THE HEAD AGAIN BY SANDRA’S THUNDEROUS BULLCOCK! ! HE’S BEEN TURNED COMPLETELY INSIDE OUT! ECLIPSE WITH THE COVER! THERE’S NO FUCKING WAY!!!!

Ref: OOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOOOO!!!! THRRRRRRRRRRRRRRRR-

Gavin Kirkland: EPSTEIN SAVES HIS LONG TIME FRIEND AND ALLY MR. DEDEDE, AND SAVES HIS ANSWERS WORLD TITLE REIGN IN THE PROCESS! IF DDD 4 EPSTEIN 4! But Epstein’s not out of the woods yet! Sandra Bullcock yanks Epstein up by the noose around his neck and is unloading with blows over the head! But Epstein sends Bullcock forward with a snapmare! Fiend Eclipse going for some offense on Epstein! Jumping superkick courtesy of GOATfrey GOATstein! And the resurrected billionaire playboy philanthropist is heading for the high rent district, which he would know a lot about! He may be looking for a moonsault!!!

Deadprez: Uh oh Axl Turner is back.

Gavin Kirkland: AXL TURNER CHARGES AT A RECOVERING MR. DEDEDE WITH THE CAKE IN HIS HANDS! BUT DDD MOVES OUT THE WAY AND SENDS AXL RUNNING INTO THE CORNER WHERE EPSTEIN IS MOUNTED! THIS CAUSES EPSTEIN TO DROP GROIN FIRST AND DANGLE UPSIDE DOWN IN THE TREE OF WOE POSITION! EPSTEIN BEING HUNG UP TO DRY THERE ON THE TOP TURNBUCKLE!

Eve: So I guess this means Epstein actually did hang himself.

Gavin Kirkland: DEDEDE CHARGES AT AXL! SPEAR!!!!!!! NO AXL MOVES OUT OF THE WAY, AND DDD SPEARS EPSTEIN IN THE CORNER INADVERTENTLY! EPSTEIN HAS BEEN KILLED YET AGAIN, BY YET ANOTHER RICH AND POWERFUL IMPLICATED BILLIONAIRE! HE COVERS HIM!

Ref: OOOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEE!!

Gina Romano: Jeffrey Epstein’s Ghost has been eliminated!

Gavin Kirkland: Axl Turner is unloading on DDD! But like I said earlier, the blows just aren’t the same when they’re on some airheaded stockholm syndrome having crater faced female! DDD is barely being effected! And he SHOVES Turner away from him! Turner charges back! CORKSCREW CROSSBODY!!! KIP UP! SANDRA BULLCOCK COMES AFTER THE GAWD WITH A SWING OF HER MIGHTY, MASSIVE, MEATY, BEEFY PULSING BULLCOCK! DUCKED UNDER BY THE GOAT ONE! ROLLING BACKFIST!!! AND DDD CHARGES AT THE CORNER WHERE FIEND ECLIPSE IS RECOVERING! RRRRRRRRRRRRRRAPTURRRRRRRRRRRRRRRRREEEEE!!!

( DEDEDE yanks Fiend Eclipse to the floor and springs up to the top turnbuckle. )

Gavin Kirkland: THE GAWD FEELING IT! HE’S UP TOP LOOKING DOWN BELOW AT FIEND ECLIPSE’S FAT ASS!!! CORKSCREW NORTHSTAR!!! AND A COVER, HOOK OF THE LEGS!

Ref: OOOOOOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEEEEEEEEEE!!!

Gina Romano: “The Fiend” Eclipse Diemos has been eliminated!

Gavin Kirkland: BACK TO THE AGEPLAY COLONY FOR YOU! The Gawd is standing over Axl, ready to put him away… but this stupid bitch Stockholm Sunshine just has no idea when to quit doesn’t she?! She’s sporting two ugly black eyes, a busted lip, a caved in nose and bruises all over her body! And now she’s spitting more blood than Rihanna on a cold February night in 09! Oh she spits blood into DDD’s face! DDD REELS HER IN, AND HE REELS AXL IN AS WELL! DOUBLE GRAND SLAM!!!! COVER ON AXL!

Ref: OOOOOOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEEEEEEEEEE!!!

Gina Romano: Axl Turner has been eliminated!

( Mr. DEDEDE gets up, standing over Axl Willow waving him goodbye. He turns around, and spots Finnegan Rapefield in the corner, challenging him to “bring it on”. )

Gavin Kirkland: AND THEN THERE WERE TWO!!! RAPEFIELD IS WASTING NO TIME HERE! HE CHARGES AT THE GAWD! BUT THE GAWD BRINGS HIM DOWN WITH A BIG BOOT! Now he’s just showing off to this audience, who are letting him hear it with very loud boo birds. The Gawd looks ready to finish this absolute classic of a chamber match and bring it to an emphatic end! HE’S LOOKING FOR THE GRAND SLAM!!!! –

Deadprez: LOW BLOW!!!

Gavin Kirkland: LOW BLOW!! THUMB TO THE GROIN FROM FINNEGAN RAPEFIELD!!! THERE’S A REASON WHY I HAD HIM AS MY SLEEPER CHOICE AND WE’RE SEEING IT ON DISPLAY RIGHT NOW! RAPEFIELD REELS DDD IN WITH A SMALL PACKAGE! NEW CHAMP!!!!!! NEW CHAMP!!!!!

Ref: OOOOOOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOOOO!!!

Gavin Kirkland: KICK OUT! RAPEFIELD IS HAVING A FULL BLOWN MELTDOWN RIGHT NOW! JARRING MEMORIES ARE ALL RUSHING BACK TO HIM! THAT ISN’T THE FIRST TIME HIS SMALL PACKAGE HAS FAILED TO DELIVER AND IT PROBABLY WON’T BE THE LAST! BUT HE NEEDS TO GO FOR SOMETHING ELSE IN THE PLAY BOOK! Rapefield sees The Gawd already recovering and he’s going for a SPEAR OF HIS OWN!!!!! NOT SO FAST!!! THE GAWD JUMPS OVER HIM! UNBELIEVABLE! WHAT IMPECCABLE ATHLETICISM FROM OUR ANSWERS WORLD CHAMPION! AND HE TURNS RAPEFIELD AROUND TO YANK HIM INTO THE DOUBLE UNDERHOOK! MK DRIVER!!!!!!!!!! DRILLS THE RAPIST INTO THE MAT! THERE’S THE COVER!

Ref: OOOOOOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEEEEEEEEEEEEEE!!!

( DING! DING! DING! )

( “Let It Go” by A$AP Ferg hits, and Mr. DEDEDE jumps up in celebration, pumping his fist and blowing kisses to the audience before snatching the Answers World Title belt out of the hands of the official. DDD gets his arm raised, and he uses his other arm to raise his title. )

Gina Romano: Here is your winner and STILL THE ANSWERS WORLD CHAMPION!!! MMMMISTEEEEEEEEEEER DEEEEEEEEEEEEE DEEEEEEEEEEEEEE DEEEEEEEEEEEEEEEE!!!

Gavin Kirkland: CONSIDER ALL THESE WEEKS OF DUCKING HARLOW REICHERT COMPLETELY UNDER THE BRIDGE! THAT WAS ONE OF THE MOST SENSATIONAL PERFORMANCES I’VE CALLED SINCE JOINING THIS COMPANY LAST YEAR! ONE MATCH IN AND THIS HAS ALREADY BEEN ONE OF THE GREATEST NIGHTS IN THE HISTORY OF OUR SPORT!

Eve: Did you have fun?

Gavin Kirkland: THAT WAS AN ABSOLUTE THRILLER! THE GAWD MAY HAVE PULLED OFF A MIRACLE, I AM ALL IN ON THE CONCEPT OF HIM BEING THE CHAMPION OF MANKIND! IN ONE FELL SWOOP HE DID AWAY WITH SOME OF THE MOST FOUL HUMAN BEINGS TO EVER WALK THE FACE OF THE PLANET. AND HE LOOKED DAMN GOOD DOING IT, DID YOU GUYS SEE HIM OUT HERE!

Eve: We didn’t exactly have a choice in the matter. Look at him! He’s celebrating like he just won Game 7 of the NBA Finals! I sure hope Mr. DEDEDE enjoyed this charade, but equally I hope he doesn’t expect Road to Redemption to be nearly as effortless as tonight.

Gavin Kirkland: WE HAVE ALL DAMN WEEK TO TALK ABOUT ROAD TO REDEMPTION, FOCUS ON THE HERE AND THE NOW! LIVE FOR THE PRESENT! THAT WAS A HIGH OCTANE, HEART PUMPING BARN BURNER AND AS USUAL THE GAWD COMES OUT ON TOP! UNDEFEATED SEASON, UNPRECEDENTED FOUR ELIMINATION CHAMBER WINS, LEGENDARY ANSWERS WORLD CHAMPIONSHIP REIGN, AND IF YOU ASK ME I THINK IT’S ONLY BEGINNING!

Deadprez: All jokes aside that last part may very well be true. DDD may have gotten to enjoy himself tonight, but Eve I think DDD knows exactly what he’s walking to in seven nights from now. This man lives for the big match, he thrives in situations where the deck is stacked to the ceiling against him, and as it is he’s been unbeatable as the Answers World Champion. I’ve never seen him at the level he is at right now, and it is going to take everything all five of his opponents have to get that belt off of his shoulders.

( DDD walks up the ramp proudly holding his title with a devious grin on his face. He is met by his wife Kassidy Heart on the ramp, and the two embrace each other with a hug and a kiss before Kassidy wraps the Answers World Championship around DDD’s waist. She raises his hand on the ramp and points to the title-clad waist of her husband, and the two continue their celebration with smiles on their faces. )

(EAW logo buzzes.)