in ,

Reckless Wiring (2013)

Our Fate is in Your Hands

Voice: Fate… What do we know about fate?

( Several clips of dictators and armies throughout the history of the World are shown )

Voice: We know more of humanity than we do of fate; we are bound to demand power and rule over others with an iron fist. However… In the face of tyranny comes democracy.

( The clips transition to tens of thousands of people walking throughout the streets of cities such as New York City as they remain glued to their cellphones and other technical products )

Voice: Democracy has reigned as a force of justice throughout history, but it is an ever evolving one. One that perhaps even defines fate to a brave new World.

( The camera rapidly zooms in on one woman walking by as she votes on the Reckless Wiring page via her cellphone )

Voice: The fate of competitors to challenge Champions…

( The camera transitions to Moses X with Alex Anderson, Hass Johsnon, GI Styles, and Tomi Venus surrounding him )

Voice: The fate of a Champion’s right to defend a prestigious Belt…

( Camera cuts to Cleopatra staring down with Elena Chase )

Voice: The fate of one who triumphs or the one who falls…

( Camera cuts to Tyler Parker staring down with Brian Daniels )

Voice: The fate of the contest that will be battled in and even the fate of something as simplistic as which type of a specific weapon will be used!

( Camera cuts to Eddie Mack staring down with Liam Catterson before cutting to Suicidal Adrenaline staring down with Pyrite and Diamond Cage )

Voice: The fate of a man’s catch twenty-two!

( Camera cuts to Y2Impact staring down with Prince of Phenomenal while Christy Cruise and Troy Conway look on in the background )

Voice: Even the fate of a man at the helm of a force that celebrates tyrannical rule over democracy… Or a soul that abandons democracy as he fights for nobody but himself.

( The camera cuts to Methuselah staring down with the Heart Break Boy before cutting to a first person view of a fan sitting at his desk with a laptop in front of him on the Reckless Wiring page )

Voice: What do we know of fate? It’s just a click away…

( The fan clicks the mouse as the screen is filled with thousands of code as “Unbroken” by Black Veil Brides begins to play )

Voice: And now… EAW Dynasty presents… THE FIFTH ANNUAL RECKLESS WIRING!!!

( The camera fades into the Wells Fargo Center as a huge barrage of blue and white pyro goes off. ‘Unbroken’ continues to play as the camera pans around the thousands of fans before it settles in on Stew-O and Hey Yo Chico )

Stew: WELCOME EVERYONE TO REKLESS WIRING 5!! We are LIVE from Philadelphia, Pennsylvania, 17,000 fans PACKED to the rafters tonight to witness a classic show, and as always… both Dynasty and EAW WON’T disappoint.

HYC: I’ve been waiting for this day for WEEKS, Stew. I’ve had the date circled on my calendar all year… I can’t believe it’s finally here!

Stew: Some magnificent matches lined up for tonight, including just maybe the biggest main event in the history of EAW! And I agree Chico, we and the fans have been waiting too long, let’s not wait a moment longer!

( Camera fades to the ring announcer )

Ring Announcer: This opening contest set for one fall…. IS FOR THE NATIONAL EXTREME CHAMPIONSHIP!!

( ‘Payback’ by Flaw hits as GI Styles makes his way to the ring )

Ring Announcer: Approaching the ring first, the challenger… from Toronto, Ontario, Canada… weighing in at 202 pounds… GI STYLLLLLEEEEEEESSSSS!!

Stew: Well in a true SHOCKER, GI Styles snuck out a poll win last minute, and finds himself competing for the National Extreme Championship here at Reckless Wiring… will he be able to take advantage of the opportunity and emerge victorious?

( ‘Love Sosa’ by Chief Keef hits as Moses X makes his way to the ring, carrying the National Extreme Championship in his hands )

Ring Announcer: And his opponent, from Washington D.C…. weighing in at 280 pounds… HE IS THE NATIONAL EXTREME CHAMPION!! MOSEEEESSSSSS XXXXXXX!!

HYC: Moses has held the championship since December, and he’s been criticized for not taking on any challengers… however I believe a win here tonight will shut those critics up. And I also believe that he will indeed get that win.

( Ding! Ding! Ding! )

Stew: There’s the bell and the match is underway… GI is at a severe height and weight disadvantage, but DON’T let that fool you, GI for his size, is VERY strong… maybe even matching the strength of the National Extreme Champion. Moses grabs GI and pulls him in, quickly applying a headlock but is quickly pushed off and sent into the ropes. GI drops his head… BUT MOSES LIFTS HIS BOOT UP AND SMACKS IT AGAINST THE CHEST OF GI STYLES!!

HYC: GI grabs his chest… and now gets taken down by a clothesline! GI makes it back to his feet… ONLY TO BE TAKEN DOWN WITH A SECOND CLOTHESLINE BY THE NATIONAL EXTREME CHAMPION!! This time GI slow to his feet, he crawls over to the corner and huddles himself up as Moses makes his way over…. He goes to grab GI but he swats Moses away by throwing out his leg and catching Moses in the mid-section! GI now up to his feet charges at Moses and connects with a forearm to the face, staggering the National Extreme Champion!

Stew: GI now with a right hand, knocking Moses into the corner… GI takes a few steps back and now comes charging!… RUNNING KNEE RIGHT TO THE STOMACH!! MOSES STUMBLES OUT OF THE CORNER AND HITS THE MAT, GI INTO THE COVER!!

ONEEE!!… TWOOO!! NO!! Moses easily tosses GI off him!

HYC: The strength may be evenly matched, but that doesn’t discount the size difference Stew, and it may just be too much for GI to handle… Moses on his knees and now makes it back to his feet… but GI clobbers Moses yet again! GI comes out with a few kicks to the side of Moses, forcing him to backpedal into the corner… GI throws a kick… but it’s CAUGHT by Moses and now he pushes him back, causing GI to fall to the mat! GI quickly gets back to his feet and darts at Moses in the corner… BUT MOSES DODGES CAUSING GI TO CRASH SHOULDER FIRST INTO THE CORNER!!

Stew: GI emerges from the corner, holding his shoulder and turns around… HE EATS A BIG BOOT BY MOSES X, GI COLLAPSES TO THE CANVAS AND MOSES IMMEDIATELY DROPS FOR THE COVER!!

ONEEE!!… TWOOO!!… NO GI GETS THE SHOULDER UP!!

HYC: Moses grabs the arm of GI and pulls him near the edge of the ring… Moses now hops over the apron and makes his way to the outside. He pulls GI Styles out of the ring and lifts him up… MOSES GRABS GI AND RAMS HIM RIGHT INTO THE CORNER OF THE RING!!… HE DOES IT A SECOND TIME… AND NOW A THIRD TIME BEFORE WHIPPING HIM INTO THE BARRICADE ADJACENT TO THE RING!! Moses picks up GI Styles and rolls him into the ring before heading to the top rope… something Moses is NOT known for!

Stew: Moses at the top, his legs wobbly, you can easily tell he’s not used to this… HE SETS HIMSELF AND DIVES OFF… CONNECTING WITH A FIST DROP!! MOSES PULLS GI BACK INTO THE CENTER OF THE RING AND AGAIN HOOKS THE LEG!!

ONEEE!!… TWOOO!!… NO GI KICKS OUT AGAIN!!

HYC: Moses sits up and begins running his hand through his hair, perhaps some frustration starting to set in. He again pulls GI Styles to his feet… BUT GI WITH A SHOT TO THE GUT… STARTING TO GAIN SOME LIFE BACK!! Moses swings for a clothesline but he misses wildly! However GI connects flush with A SPINNING BACKFIST!! And it hangs Moses up on the top rope! GI takes a few steps back and comes running… A KNEE RIGHT TO THE BACK OF MOSES’ HEAD!!

Stew: Moses falls back and hits the mat… GI NEEDS to take advantage here… he quickly pulls Moses up… AND HE GETS HIM OVER HIS SHOULDERS, WOW!! A GREAT DISPLAY OF POWER SHOWN HERE BY GI STYLES!! BUT MOSES SLIDES OFF THE BACK OF GI, SPINS HIM AROUND AND LEVELS HIM WITH ANOTHER BIG BOOT!! Moses leans himself up against the ropes… a grin begins to develop… perhaps he sees the end in near!

HYC: He grabs GI and tosses him over his shoulders… MX FACTOR ON THE WAY!! MOSES DROPS HIM AND—IT’S BLOCKED!! BLOCKED BY GI STYLES WHO NOW ROLLS UP THE NATIONAL EXTREME CHAMPION, LOOKING FOR THE WIN, AND FOR THE TITLE!!

ONEEE!!… TWOOO!!… NO!! MOSES ESCAPES THE ROLLUP AND MAKES IT BACK TO HIS FEET!!

HYC: Moses quickly up to his feet before GI could go back on the offensive. He begins to circle around the ring… cautiously, perhaps he didn’t quite prepare for this match as much as he should’ve. GI tries to sweep the leg of Moses to take him off his feet but Moses catches him… AND SLAMS HIM INTO THE CANVAS WITH A SIDEWALK SLAM!! MOSES DELIVERS A HUGE SIDEWALK SLAM DELIVERED TO GI STYLES AS HE BOUNCES OFF THE RING SURFACE!! He follows that up with a stomp right to the chest of the challenger!

Stew: Moses with a second hard stomp to the chest… almost toying with him. He lifts GI up and tosses him into the turnbuckle, he throws a few right hands to the face, almost toying with him!! Moses takes a few steps back… AND NOW COMES RUNNING… A HUGE TURNBUCKLE CLOTHESLINE!! SNAPPING THE SPINE OF GI STYLES AS IT CRACKS AGAINST THE TURNBUCKLE!! GI COLLAPSES TO THE GROUND IN OBVIOUS PAIN AS HE HOLDS HIS LOWER BACK… and now Moses has that look in his eye!

HYC: He gets behind GI as he attempts to make it back to his feet… MOSES WINDS UP HIS ARM… GI UP AND HE TURNS AROUND!! MOSES RUSHES AT GI WITH THE BURNING ARROW… BUT NO!! GI DUCKS!! GI DUCKS UNDER THE BURNING ARROW… AND NOW FROM BEHIND HE GRABS MOSES… DEADLIFT GERMAN SUPLEX!! IT CONNECTS!! GI CONNECTS!! AND NOW BRIDGING THE PIN, HE’S GOT IT!!

ONEEE!!… TWOOO!!… THREEE!!… WAIT… MOSES KICKS OUT!!… NO!! THE REFEREE IS CALLING FOR THE BELL!! GI GOT THE THREE!!

( Ding! Ding! Ding! )

( ‘Payback’ hits as GI Styles is awarded the National Extreme Championship )

Ring Announcer: Your winner… AND NEW NATIONAL EXTREME CHAMPION… GI STTTYYYYYLLLLEEEESSSS!!

Stew: And WHAT A WAY to open up Reckless Wiring as we crown a brand new National Extreme Champion!

HYC: I’m shocked Stew, I really am… I didn’t think there was a chance in hell GI would be walking out the champion, I thought this would be the night where Moses proved himself to everyone and showed that he’s ready to take that next step.

( Moses is shown arguing with the referee )

Stew: But… I don’t know Chico, but it looked to me like Moses kicked out..

(Camera cuts backstage to a smiling Max A. Million with a microphone in hand)

Max: Ladies and gentlemen, we are here at Reckless Wiring and it has already gotten off to a HUGE start as we’ve already witnessed two huge Championship contests and another one coming up as you, the fans, have voted and you have decided the fate of the contest in which my guest at this time will be competing in. Please welcome Elena “The Checkmate” Chase!

(The camera pans to the right to reveal Elena Chase fully ready in her attire for her upcoming contest)

Max: Now Elena, it’s no secret that you’ve been against the ability for the fans to vote on stipulations regarding the contests for tonight such as the one for your match in which they’ve voted as to whether or not Cleopatra will have to defend her Vixens Championship tonight, but they have in fact voted for her to put it on the line. Does that change your perspective on it?

Elena: What’s that supposed to mean? Are you implying that by rejecting this “our fate is in your hands” crock that I was just doing it to be some sort of rebel without a cause? That I was playing reverse psychology upon the EAW fans in order to garner votes? Psychology is not something that simply anyone can do. There is no such thing as psychological warfare unless the competitor using it has a vast knowledge of its capabilities and more than enough experience to pull it off and though I may be a person who can pull it off, I am not one to stoop to such cheap tactics. Cheap tactics that my opponent in Cleopatra has based her entire career off of as she just barely clings to her life support in her adorable and pathetic Project E.G.O stable. I’m not even going to give her the credit so many think she deserves and call it some sort of “tactician” for her efforts just because she can play a few games that even children can master. To answer your question, Max, no. My perspective has not changed on the way this event is handled by any stretch of the imagination. It’s risky, dangerous, and a slap to the face of the entire Vixens division. The Vixens Championship should have been placed on the line the very moment this match came true, because I have been a force to be reckoned with and that is something that nobody can deny. Man.. Woman.. I don’t care what gender you are. You’re just competition to me and that is something I myself have made a living out of “edging” out. However, I’m not one to group myself in with a bunch of morons and degenerates like my opponent tonight in Cleopatra. I’m not one to group myself with fools and then roam around mobbing people with no real leader taking the helm of the alliance. That’s the problem with this lackluster democracy and that’s the problem with Cleopatra and her allies; either a leader with the skills to lead others to victory or anarchy reigns. Simple as that.

Max: That’s… That’s quite a mouthful. Anything else you’d like to add?

(A smug smile appears across the face of Elena)

Elena: I think I do… I’ve got some final words for this longest reigning Vixens Champion of our’s. This pathetic woman that clings to overused and underthought tactics. Tonight, Cleopatra, I show you the difference between tactics and strategy and I do it in a way you and your comrades should have been taught a long time ago.. By making an example out of you. Checkmate.

(Elena Chase walks off as Max A. Million looks on)

(Camera cuts back to the ring as several Glass Tables are seen laid out around the ring or set up down the ramp)

Announcer: The following tag team contest is a GLASS TABLES MATCH!!…. AND IT IS FOR THE EAW UNIFIED TAG TEAM CHAMPIONSHIPS!!!….

(“God’s Gift” by J. Cole plays all throughout the arena as the team of Pyrite and Diamond Cage arrogantly make their way out to the stage; both wielding steel baseball bats)

Announcer: First, making their way to the ring!… The challengers!…. Weighing in at a combined weight of–

Stew: HOLD THE PHONE–SUICIDAL ADRENALINE IS OUT HERE AS THEY CATCH CAGE AND PYRITE FROM BEHIND!! ALL FOUR MEN HAVE ERUPTED INTO A BRAWL ATOP THE STAGE!! NONE of these men are wasting absolutely ANY time here tonight as the reigning Tag Team Champions have fallen victim to CONSTANT attacks similar to this at the hands of the two challengers and as a result we’ve gotten a very personal ongoing feud here between these two teams as fists are sent flying all over the damn place! Pyrite and Cage have unintentionally dropped their bats after the unsuspecting attack from the Tag Team Champions as it seems this contest is evened up now! Suicidal VIP and Pyrite are now going at it over by the barricade on the side of the ramp as Zack Crash and Diamond Cage are brawling at the top of the stage!

HYC: None of these men are taking what is surely to be a brutal contest lightly here tonight at Reckless Wiring in Philadelphia; the HOME of Extreme and they’re paying homage here in spades as Zack Crash DRIVES Cage’s skull right into the bottom of the titantron!! VIP is just LAYING into a now defenseless Pyrite with just unrelenting shots over and over into his skull! Pyrite could be on the verge of being the first man to shed blood in this contest, but he will most definitely NOT be the last! Pyrite quickly catches VIP off-guard and DRIVES him head-first into the steel barricade!! You can now see the blood trickling from the forehead of Suicidal VIP! He’s busted open! Meanwhile, on the stage, Cage has his opponent in his grasp now after taking control in the brawl between he and Zack as he edges himself and Zack towards the edge of the stage! Cage locks the waist of Zack! No!

Stew: Zack quickly breaks through Cage’s grip and reverses into a waist lock of his own on his opponent from behind! Zack is now just driving several clubbing forearms to the spine and back of the head of Diamond Cage! Zack’s setting him up! BELLY TO BACK SUPLEX OFF THE STAGE!!! NO! Cage rolls off the back of Zack and onto his feet JUST on the edge of the stage!! Zack’s looking to finish the job as he lays into Cage with a couple unforgiving elbows! Cage drops off the stage and onto the concrete below! CAGE PULLS ZACK’S FEET OUT FROM UNDER HIM, CAUSING HIM TO FACEPLANT WITH GREAT FORCE ONTO THE STAGE!!

HYC: Cage slides the possibly unconscious Zack Crash off of the stage… And now Cage with an Irish whip! ZACK IS SENT SPINE-FIRST INTO THE STEEL BARRICADE OVER BY THE SIDE OF THE STAGE!! Zack falls to his knees, cringing in pain! Pyrite now could be looking to end this as a he takes advantage of a bloodied Suicidal VIP as both men are now back on the ramp with those couple already set up Glass Tables in tow.. Pyrite DRIVES VIP into the surface of the nearest glass table! Those tables are harder to bust than ordinary wooden tables as all it does is leaves a bloody stain where VIP’s skull collided with it! Those glass tables are very thick, so it’s going to take some real force to send your opponent through them and I think Pyrite realizes that now as he.. HE PULLS VIP IN!! PYRITE PICKS VIP UP!! THIS IS BAD! THIS IS VERY VERY BAD!! NO! VIP IS FIGHTING IT! VIP IS FIGHTING BACK NOW!

Stew: VIP IS SENDING SHOT AFTER SHOT INTO THE SKULL OF PYRITE, DOING EVERYTHING HE CAN TO KEEP HIMSELF FROM BEING SENT THROUGH THE GLASS TABLE!! VIP REVERSES INTO A HURRICANRANA!! Pyrite is sent COLLIDING spine-to-glass with the edge of the second already set-up Glass table on the ramp! What a series of close calls! VIP’s now struggling to get back to a vertical base here… He’s up! DIAMOND CAGE DRIVES VIP INTO THE EDGE OF THAT SECOND GLASS TABLE!! VIP is down and out just as Zack Crash is over by the side of the stage as Cage and Pyrite are in position to take full advantage… Pyrite is definitely still feeling the after-effects of that hurricanrana, but Cage couldn’t seemingly care less as he orders Pyrite to navigate that second Glass Table over towards the ring while it seems he’s going to go to work on VIP.. Cage now.. He sends VIP straight into the edge of the ring apron with a merciless Irish whip!

HYC: You can just see the pain VIP is going through as blood continues to stream down his face as his spine meets that unforgiving apron! Cage pulls VIP back to his feet now.. As Pyrite complies with Cage’s wishes and drags that Glass Table next to the ring apron! CAGE SENDS VIP INTO THE STEEL STEPS! NO–REVERSED! CAGE IS SENT CRASHING INTO THOSE STEPS WITH GREAT FORCE!! Zack Crash is back in this now as he limps towards the fight.. Pyrite grabs a hold of VIP! Zack with a shot to the back of Pyrite! Pyrite is downed as Cage seems to be fighting back against VIP! Zack DRIVES Cage into the nearest ring post! Crash could be looking to go for something big now as he climbs up to the ring apron.. Pyrite with a forearm to the gut of Zack! Pyrite climbs up to the apron to continue his attack.. VIP FROM BEHIND! VIP LOOKING FOR A POWERBOMB THROUGH THAT SET UP GLASS TABLE ON PYRITE!! PYRITE’S CLINCHING THE ROPES FOR DEAR LIFE!! HE’S NOT LETTING GO!!

Stew: ZACK CRASH FORCES PYRITE TO LOSE HIS GRIP ON THE TOP ROPE!! PYRITE I SENT THROUGH THE GLASS TABLE WITH INCREDIBLE FORCE AT THE HANDS OF VIP!!!! BAH GAWD ALMIGHTY!! PYRITE IS LEFT IN A HEAP OF SHATTERED GLASS!!

(DING! DING! DING!)

HYC: Wait… Did the match even BEGIN?! DIAMOND CAGE IS IN THE RING WITH A GLASS TABLE IN HAND! HE DRIVES THE EDGE INTO THE BODY OF ZACK CRASH!! The Referee is informing Suicidal VIP that this match had NOT yet begun as neither team had entered the ring! It seems as though it’s no underway as Cage sets up that glass table as Zack Crash writhes in pain on the mat here on the outside… VIP climbs up to the apron! Climbing up to the top turnbuckle! VIP’S LOOKING TO FLY!! NO! CAGE HAS IT SCOUTED AS HE NAILS VIP WITH A CLOSED-FIST SHOT TO THE TEMPLE! CAGE PICKS UP VIP OFF THE TURNBUCKLE AND NAVIGATES HIM TOWARDS THE TABLE IN THE RING!! VIP IS FIGHTING OUT OF IT!! DIAMONDS ARE FOREVER!!!! THE DIAMONDS ARE FOREVER CONNECTS THROUGH THE GLASS TABLE!!!!

(DING! DING! DING!)

(“God’s Gift” by J. Cole plays all throughout the arena as a shocked and hurt Zack Crash slides back in the ring; too late to save his partner as Diamond Cage is handed both Unified Tag Team Championships)

Announcer: The Winners of this match and NNNNNNEEEEEEEEWWWWWWW EAW UNIFIED TAG TEAM CHAMPIONS!!!….. PYRITE AND DIAMOND CAAAAAAAAAAGGGGGGGGGEEEEE!!!!….

Stew: AND WE’VE GOT NEW TAG TEAM CHAMPIONS HERE AT RECKLESS WIRING!! Diamond Cage and Pyrite knock off Suicidal Adrenaline, the longest reigning Tag Team Champions in history!

HYC: VIP and Crash have had a great reign, no doubt… but now it’s time to usher in new champs… and let me tell you, these two, Cage and Pyrite are going to be a force to be reckoned with in the tag team division!

(Camera cuts backstage to a livid Moses X as he exits the Trainer’s Room and begins storming his way through the backstage area)

Moses: Where is he?! Where is he?!

(Moses X stops a passing backstage worker)

Moses: Where the hell is GI Styles?

Worker: I… Uh, GI Styles?

Moses: WHERE IS GI STYLES?!

(The backstage worker’s expression turns to a fearful one as he attempts to back up only for Moses to grab him by the shoulders)

Moses: I did not lose my National Extreme Championship! Do you understand?! It was supposed to be Hass Johnson or Alex Anderson! I was supposed to face either of those idiots and he.. He CHEATED to win that poll! He CHEATED to STEAL my National Extreme Championship! I KICKED OUT!! This entire event has been one massive conspiracy to screw me out of MY National Extreme Championship and it has been the very moment I was forced into this bullshit situation in which these idiots got to vote for somebody to face me and giving me only THREE days to prepare! GI Styles is a nobody to this company, do you understand that?! He’s a NOBODY! Now where is he?!

Worker: I… Please, I’m sorry, there’s nothing I can do! I don’t know where he is?

Moses: Is that right? Then where is Masters? Tell me where the Hell that hasbeen is!

Worker: I just started here, I have no idea!

Moses: Well aren’t you just USELESS!

(Moses X throws the worker into the nearest cement wall)

Moses: You’re USELESS!

(Moses continues on his path of destruction as he knocks over a couple catering tables and pushes a few other workers out of his way)

( Camera fades to ringside as the Vixens Championship Logo flashes across the screen )

Ring Announcer: The following contest scheduled for one fall… IS FOR THE VIXENS CHAMPIONSHIP!!

( ‘Cell Theme’ by Bruce Faulconer hits as Elena Chase makes her way to the ring )

Ring Announcer: Approaching the ring first, the challenger, from Berlin, Germany… ELEEEEENNNNAAAA CHHHHAAAAAASSSSSSEEEEEEEE!!

Stew: This bright young vixen has the opportunity of a lifetime tonight as she takes on Cleopatra for the Vixens Championship… she’s been quite impressive in her short time with EAW, but can she win the big one tonight?

( ‘So Hard’ by Rihanna hits as Cleopatra makes her way to the ring with the Vixens Championship around her waist )

Ring Announcer: And her opponent… from Montreal, Quebec, Canada… SHE IS THE E.G.O. VIXENS CHAMPION!!… CLEEEEOOOOOPAAATTTRRAAA!!

HYC: Not if Cleo has anything to say about it, Stew. She’s already bitter at the fact she has to defend her championship here tonight, and I think because of that anger and bitterness it’s going to cause her to kick it up a notch and reach a level we have yet to see… and if that happens… Elena BETTER watch out.

( Ding! Ding! Ding! )

Stew: Cleo quickly rushes at Elena, starting the match forceful as she attacks her and forces her back into the ropes! She lands a few clubbing blows across the top of the head before whipping her into the ropes… Elena comes rebounding back but Cleo knocks her off her feet with a shoulder block! Elena quickly rolls over to the edge of the ring and uses the ropes to pull herself up… BUT HERE COMES CLEO CHARGING AND SHE CONNECTS WITH A CLOTHESLINE!! THE CLOTHESLINE FLIPS BOTH ELENA AND CLEO OVER THE ROPES AND THEY BOTH LAND HARD ON THE OUTSIDE!!

HYC: Cleo gets to her feet and pulls Elena back up to her feet… AND SHE WHIPS HER RIGHT INTO THE CORNER RINGPOST!! Elena hits spine first… she grabs her back as she walks forward, away from the ringpost… BUT CLEO AGAIN PUSHES ELENA BACK INTO THE RINGPOST!! Elena winces as Cleo grabs her and rolls her into the ring before rolling herself back in… Elena on her knees trying to make it back to her feet… BUT CLEO LAYS HER OUT WITH A KICK TO THE SIDE OF THE HEAD!! ELENA FALLS TO THE MAT, THE VIXENS CHAMPION IS DOMINATING RIGHT HERE!!

Stew: I’m afraid you might be right, Chico! Since the onset of this match, Elena Chase hasn’t gotten one bit of offense in, it’s been all Cleopatra to this point! She pulls Elena to her feet… but Elena with a shot to the head breaking it! Cleo however comes back with her own right hand, bringing Elena back down to her knees. She pulls Elena up and hooks for a suplex! BUT ELENA IS TRYING TO BLOCK IT!! ELENA NOT LETTING CLEO LIFT HER UP!! INSTEAD ELENA CONNECTS WITH A SUPLEX OF HER OWN!! DROPPING THE VIXENS CHAMPION, SHOWING SOME LIFE HERE!!

HYC: This is the opening that Elena needs if she wants to weave her way back into this match! She mounts on top of the Vixens Champion and throws a few right forearms before grabbing the arm and applying an armbar! Elena with the armbar applied here… perhaps trying to make the Vixens Champion tap out here! Cleo however not that far away from the ropes is easily able to reach them! She tries to roll her way out of the ring but Elena catches her and pulls her into the center of the ring and drops an elbow into the mid-section!

Stew: Elena grabs the arm again… LOOKING TO APPLY THE ARMBAR FOR A SECOND TIME, AND THIS TIME AROUND, THEY ARE NOWHERE NEAR THE ROPES!! BUT CLEO QUICKLY ROLLS ONTO HER STOMACH AND BREAKS THE HOLD!! She gets up… Elena extends her knee for a kick but Cleo catches it and now sweeps the leg, taking Elena down! Elena lands hard, hitting her head first against the canvas but the German Military trained Vixen makes it back to her feet rather quickly… CLEO SPINS HER AROUND AND CONNECTS WITH A TOE KICK… AND OH MAN!! SUNSET FLIP!! CLEO WITH THE SUNSET FLIP AND NOW THE PIN!!

ONEEE!!… TWOOO!!… NO THE CHALLENGER KICKS OUT!!

HYC: Cleo does a backward somersault to get untangled from Elena before popping up to her feet… She grabs the challenger by the hair and pulls her up… she goes for a clothesline… BUT MISSES WILDLY AND HER MOMENTUM TAKES HER INTO THE CORNER… AND NOW ELENA WITH A SUDDEN BURST OF ENERGY BEGINS POUNDING INTO THE VIXENS CHAMPION!! ELENA GETTING HER SECOND WIN HERE!! SHE GRABS CLEO AND WHIPS HER INTO THE OPPOSITE CORNER BEFORE SHE COMES CHARGING… BODY SPLASH!! BODY SPLASH TO CLEO IN THE CORNER!! ELENA TAKES A FEW STEPS BACK… AND NOW CONNECTS WITH A SECOND BODY SPLASH!!

Stew: The Vixens Champion suddenly finds herself in a world of trouble as she comes stumbling out of the corner… BUT ELENA CATCHES HER AND SLAMS HER INTO THE MAT WITH A LEAPING REVERSE STO!! ELENA SHOOTS THE HALF AND HOOKS BOTH LEGS, LOOKING FOR THE VIXENS CHAMPIONSHIP HERE AT RECKLESS WIRING!!

ONEEE!!… TWOOO!!… AND NO!! CLEO GETS THE SHOULDER UP!!

HYC: Elena up, the Vixens Champion follows… Elena with a swift knee to the mid-section… AND NOW CONNECTS WITH A BELLY TO BELLY SUPLEX!! CLEO THROWN ALMOST HALF WAY ACROSS THE RING!! Cleo quickly back to her feet… using the ropes, she turns back around… DROPKICK!! DROPKICK BY ELENA CHASE, RIGHT TO THE HEAD!! CLEO AGAIN DOWN!! Elena contemplates going for the pin… BUT INSTEAD HEADS OUT ONTO THE APRON AND BEGINS CLIMBING THE TURNBUCKLE!!… CLEOPATRA DOWN BUT STARTING TO STIR!! ELENA MAKES IT TO THE TOP AND SETS HERSELF JUST AS CLEO GETS BACK TO HER FEET!!… ELENA LEAPS OFF!!

Stew: AND SHE CONNECTS WITH THE CROSSBODY!! CROSSBODY ONTO TH—WAIT NO!! CLEO!! CLEO ROLLED THROUGH!! CLEO ROLLED THROUGH THE CROSSBODY AND HAS THE PIN, DOES SHE HAVE HER HERE?!?!

ONEEE!!.. TWOOO!!… THR—NO ELENA WITH THE SHOULDER UP RIGHT BEFORE THE THREE!!

HYC: OH BUT LOOK AT CLEO!! LOOK AT CLEO!! SHE APPLIES THE CLEO LOCK!! CLEO LOCK APPLIED ON THE CHALLENGER ELENA CHASE WHO FINDS HERSELF IN A DESPERATE SITUATION HERE!! ELENA CHASE FINDS HERSELF IN THE MIDDLE OF NOWHERE… NO ROPE TO AID HER, NO OBJECT TO HELP HER BREAK THE HOLD… AND CLEO REARS BACK… TRYING TO GET ELENA TO SUBMIT… BUT SHE WON’T!! CLEO NOW DROPS TO HER BACK, KEEPING THE HOLD APPLIED, ADDING MORE PRESSURE TO THIS ALREADY DEVASTATING SUBMISSION, BUT ELENA STILL REFUSING TO GIVE IN!!

Stew: CLEO SCREAMING, SCREAMING AT THE TOP OF HER LUNGS, TELLING ELENA TO TAP OUT, BUT SHE’S HANGING ON!! ELENA’S FACE TURNING RED… SHE TRIES REACHING THE ROPES… BUT THEY’RE JUST TOO FAR!! SHE CAN’T REACH THEM!! THEY’RE AT LEAST ANOTHER ARM’S LENGTH AWAY!! ELENA’S FACE NOW TURNING ALMOST PURPLE… CLEO REARS BACK EVEN MORE… AND NOW ELENA STOPS STRUGGLING AS IF THE LIFE HAS BEEN SUCKED OUT OF HER!! CLEO KEEPS REARING BACK AND THERE’S NO RESPONSE FROM ELENA!! THE REFEREE HAS NO CHOICE BUT TO RING THE BELL!!

( Ding! Ding! Ding! )

( ‘So Hard’ hits as Cleopatra celebrates with the Vixens Championship )

Ring Announcer: Your winner… AND STILL VIXENS CHAMPION!!… CLEOOOOOPPPATTTRRRAAAA!!

Stew: And Cleopatra retains the Vixens Championship after one wail of a match with Elena Chase who might I add folks, DID NOT tap out tonight, she refused to give up… she passed out and the referee had to call for the bell.

HYC: Elena showed a ton of heart out here tonight, don’t think that won’t go unnoticed, this won’t be the last time we see her competing for the Vixens Championship… I guarantee you that much.

(Camera cuts backstage to Clyde standing with a microphone in his hand)

Clyde: Evenin’ ladies and gents, it’s ya boy Clyde here and the night has been a helluva an event so far and it’ll only get that much better when my boy, Brian Daniels, beats that Tyler Parker ass and–

(The index finger of Brian Daniels hovers over Clyde’s mouth as Daniels steps into view of the camera)

Brian: I already know what you’re gonna say, Clyde, and you’re absolutely right. No doubt about it; I’m going to beat Tyler Parker’s ass despite of all that we’ve been through over the years, because none of that matters anymore, right? The only thing that matters now is the beautiful prize known as the E-A-W New Breed Championship and the satisfaction of sending the loser to the bottom of the list in the 2013 Grand Rampage match.

(Clyde chuckles and cracks a smile as he hands Daniels the microphone)

Clyde: Preach it, mayne, preach it.

Brian: I think I’ll do just that, because you see, from the very moment I stepped back into the company with the goal in mind of cleaning the slate and finishing the legacy that I have been in the process of building for over three years… From that very moment, I was blocked by an envious, sad, pathetic little man known as Tyler Parker. Now I’m glad he’s told the World of the trials and tribulations I’ve gone through, but to stereotype me and tell everyone in the arena and the millions watching at home that Brian Daniels is good for nothing but dropping the ball he’s given and going home.. I’m afraid I’ll have to put an end to that urban legend of his and that starts tonight, because if we want to talk about “facts” that we’ve come up with to sling mud at each other then I could go as far as to say that Tyler Parker is nothing but a consistent failure for what, five or six years now and still going? I could say Tyler Parker doesn’t know when to shut his mouth and that’s exactly what kept his name on the “prohibited” list in EAW for a good, long time. I COULD say Tyler Parker has no business talking about expired chances in this company when he wrote the damn book on that. I–

(The sound of clapping can be heard from a short distance as an interrupted Brian Daniels and Clyde turn to Liam Catterson sarcastically clapping with a grin of arrogance on his face)

Daniels: Is there a problem?

(Liam swipes the microphone from Daniels’ hand)

Liam: Oh yeah, I’ve definitely got a problem. Who in the Hell thought it was a good idea to waste what precious time we have at Dynasty’s BIGGEST exclusive event of the year on someone who can’t even stick around for more than two months without getting himself fired or quitting? Clyde, you should be conducting this interview with someone who has been on top of this brand and the true face of this company since day one. You should be conducting this interview with someone who doesn’t have “indefinite hiatus” even in his vocabulary, because you should be conducting this interview with ME, the reigning 2013 King of EXTREME and the man that is going to put that joke of a briefcase-holder in Eddie Mack out of his misery.

(Brian Daniels swipes the microphone back)

Brian: I’m sorry, but… Who the Hell are you?

(Liam Catterson chuckles before swiping the microphone back)

Liam: Have you already forgotten? I’m the guy who BEAT you on the last Dynasty, so I’d be careful with what you say. You’re looking at the future greatest World Champion this company has ever witnessed, after all.

(Liam and Brian struggle for the microphone)

Brian: Is that right?

Liam: That’s right.

Brian: Yeah?

Liam: Yeah.

Brian: YEAH?

Clyde: YES!

Liam and Brian: SHUT UP!

(Brian takes back control of the microphone as he swipes it back from Liam’s grip)

Brian: You know what? Great, more power to ya. Go on believing that while I go on to win tonight and still enter the 2013 Grand Rampage and after I win that too I’d LIKE to say I’ll beat your ass for whatever World Championship you have in mind… But let’s face it, after what Eddie Mack does to you tonight, you won’t make it that far, regardless of your cute little crown.

(Brian Daniels shoves the microphone into the chest of an angered Liam Catterson and walks away)

( Defiance teaser plays )

(Video package plays; highlighting Brian Daniels and Tyler Parker’s simultaneous returns to EAW and rivalry)

(Camera cuts back to the arena as “A Cut Above” by Avery Watts plays all throughout the arena as a confident Brian Daniels makes his way out to the stage)

Announcer: The following contest is scheduled for ONE fall!…. It is for the vacant NEW BREED CHAMPIONSHIP!!… And the loser will be given the Number One spot in the 2013 Grand Rampage match!!…. First, making his way to the ring…. From New York City, New York!…. Weighing in at 223 pounds!…. BRRRRRRIIIIIIIIIIIIAAAAAAAAANNNNNN DANIELS!!!….

Stew: This will definitely be a unique contest as we’ll FINALLY get to see these two young men go at it and with a whole lot on the line that’s more than we bargained for as the winner will go on to reign as the new New Breed Champion whilst the loser is forced to take the dreaded number 1 spot in the Grand Rampage contest. However, Brian Daniels is looking as confident as ever and he seems just as intent as his opponent on coming out victorious in this.

(“Revival” by Orgy plays all throughout the arena as a Tyler Parker makes his way out to the stage with a smug smile upon his face and an official “Depravity” t-shirt on)

Announcer: And his opponent!…. Now making his way to the ring…. From Syracuse, New York!…. Weighing in at 223 pounds!…. TTTTYYYYYYYYYYLLLLLEEEERRRRR PARKER!!!….

HYC: Well Brian Daniels is a great athlete, no doubt about that, but MY money is on this man right here in Tyler Parker. He took an unsuspecting hiatus while he was on a roll with his partner, Charles, as a GREAT tag team in Synergy and he could be looking for some sort of redemption tonight in singles competition as he looks to silence his rival right here in Philadelphia!

(DING! DING! DING!)

Stew: This match is underway as both of these young men almost immediately circle the ring as both look for the other to make the first move.. They may be competing for the New Breed Championship, but Tyler Parker and Brian Daniels are seasoned pros and they’re showing off some great technique here as they size one another up. Both men cautiously making their way towards one another in the middle of the ring.. And there’s the lock up! It’s quickly become a struggle for power now as they’ve locked up and… Daniels is the first to take advantage as he catches the left arm of Tyler Parkers and weaves under to wrench it! Tyler’s quick to counter it into an armdrag! Daniels quickly gets back to his feet and charges back! Tyler catches Brian with a kick straight to the solar plexus and immediately looks to take control himself now as he grabs a hold of Brian’s right hand.. Greco-roman knuckle lock in on Daniels! You can see the pain on Daniels’ face as he’s sent reeling into the ropes, but Tyler isn’t letting up as he applies more and more pressure!

HYC: Daniels seizes the moment as he uses his free arm to connect with an elbow into the wrist of Parker! Daniels immediately follows up with a hip toss as he sends Tyler completely over the ropes and to the outside!! What a combination from the former Unified Tag Team Champion! Tyler’s spine just NAILED that canvas on the way down and that may very well dictate the rest of this contest for him, because that right there could have very well resulted in a serious injury! Tyler struggles back to a vertical base here on the outside as he uses the apron to pull himself back up.. Daniels rushes in! Baseball slide connects into Tyler Parker! Tyler’s sent slamming spine-first into the Spanish announce table as Daniels gets back to his feet, looking to go for something even bigger possibly! Daniels coming off of the ropes! SUICIDE DIVE!! TYLER SIDESTEPS IT!! DANIELS CRASHES AND BURNS INTO THE FRONT OF THE ANNOUNCE TABLE! Both of these athletes may be in the same position right about now as you could vividly see Brian’s spine bounce RIGHT off the edge of the table!

(Replay of Tyler Parker sidestepping the suicide dive from Brian Daniels is shown)

Stew: Well despite the damage both men have taken to the spine thus far in this contest, Tyler Parker sees his golden opportunity and he’s planning on capitalizing as he pulls a visibly hurt Brian Daniels back to his feet…Grabbing Daniels by the back of his head! Tyler DRIVES Daniels backwards right back into the edge of the Spanish announce table as his possibly already injured back bounces right off of it! Daniels cringes in pain as he drops to his knees here on the outside.. Tyler’s got a grin upon his face and you can easily tell why; he’s got complete control over this contest and his rival right here and now as he.. Tyler sends a powerful kick across the chest of Daniels! A loud “thud” can be heard as Tyler follows up with a second sickening kick to the sternum of Brian Daniels! Tyler’s got a devious smile upon his face as he’s verbally taunting his opponent; humiliating Brian with Brian’s own traditional series of kicks! Tyler Parker finishes up the attack with an onslaught of several more kicks straight into the unguarded chest of Brian! Not letting up! Not relenting! Daniels is in trouble!!

HYC: Tyler could be looking for one more thunderous kick! No! Tyler switches strategies as he drags the damaged Brian Daniels back to his feet.. Tyler picking him up.. DRIVES BRIAN INTO THE NEAREST RINGPOST!! You can just read the pain shooting through the body of Brian Daniels from those expressions of agony upon his face as he stumbles forward; his spine definitely taking the most damage here as Tyler finishes off the attack with a devastating KNEE to the bread basket of Daniels out of nowhere! Brian is dropped to his knees once again at the hands of his rival, but that’s not going to last long as Tyler pulls him back up.. Sending Daniels rolling back into the ring.. Tyler slides in! TYLER COVERS DANIELS FOR THE PIN! THIS COULD BE IT!!

Referee: ONE!!!!!!!……. TWO!!!!!!!!!!!……

Stew: FOOT ON THE ROPES! Brian Daniels manages to prevail through the cover with his left foot hanging upon the bottom rope as the Referee takes notice and informs a surprised Tyler Parker that this contest is still going! Parker replies by stomping into the foot of Brian Daniels placed upon the bottom rope! Daniels writhes in pain on the canvas, but Tyler’s looking for something as he drags the damaged Daniels into the middle of the ring now.. TYLER GOES DOWN AND HOOKS BOTH LEGS OF BRIAN THIS TIME FOR THE PIN!! HE COULD HAVE IT!!

Referee: ONE!!!!!!!……. TWO!!!!!!!!!

HYC: Brian Daniels powers out of it! Daniels is NOT giving up! Not yet! In fact, I think Brian may very well have gotten out of the pinning attempt quicker this time as he could very well be building up some sort of momentum for himself in this contest and that is something Tyler Parker is DEFINITELY going to want to put a stop to! Parker is back on the offensive now as he rushes to pull a battered Brian Daniels slowly back to a vertical base here in the middle of the ring as he.. DANIELS SPRINGS UP AS HE DRIVES BOTH MEN INTO THE CORNER! Daniels swings with a buzzaw-like kick to the chest of Tyler Parker! Tyler’s looking to stop the attack as he swings with a right hook! Daniels has it scouted as he ducks the hook as both men trade places! Tyler swings around JUST as he’s met with a second UNFORGIVING kick to the sternum!! Daniels is looking to make a big comeback here as he grabs a hold of Tyler and switches places with him; effectively trapping his opponent in the corner of the ring! There’s a third kick to the chest! A fourth! A FIFTH! A SIXTH!! SEVENTH!!

Stew: TYLER PARKER’S NOT LETTING IT HAPPEN AS HE QUICKLY RISES TO HIS FEET AND SENDS DANIELS INTO THE RINGPOST!! Tyler seems to have desperately attempted to keep this contest in his favor and he MAY have just succeeded! Daniels collided HARD with that ringpost and may have suffered an injured shoulder blade because of it! Tyler’s looking to follow up here as he drags Tyler out of the corner… HE’S SETTING HIM UP!! ACROSS THE PARK!!!! THE ACROSS THE PARK CONNECTS!!!! TYLER PARKER DROPS DOWN AND HOOKS A LEG OF DANIELS FOR THE COVER!! NEW NEW BREED CHAMPION!!!

Referee: ONE!!!!!!!……. TWO!!!!!!!!!!……… THREE!!!!!!!!!!!!!!!!

HYC: NO! DANIELS ONCE AGAIN WITH A FOOT ON THE ROPES!! Tyler Parker celebrates just a moment too soon as he’s informed of the rope break! He’s LIVID! Tyler pushes the Referee out of his way and shows a much more aggressive side as he grabs a hold of Daniels… Pulling him back to his feet.. TYLER PULLS DANIELS IN!! PICKING HIM UP!! DEPRAVITY!!!! NO–DANIELS SHIFTS HIS WEIGHT, ALLOWING HIMSELF TO DROP BACK TO HIS FEET!! SNAKE EYES!!! Tyler Parker collides with the top of the ringpost with a DEVASTATING snake eyes from Brian Daniels!! A dazed Tyler slides off.. CAUSTIC ECHO!!!! THE CAUSTIC ECHO TO THE BACK OF THE SKULL OF TYLER PARKER AS HE STUMBLES INTO THE CORNER!! Tyler turns around with a glazed over look in his eyes! HE SWINGS FOR DANIELS! CAUSTIC ECHO!!!! A SECOND CAUSTIC ECHO CONNECTS AS TYLER DROPS TO THE CANVAS!! DANIELS MAKES THE COVER, HOOKING BOTH LEGS!!

Referee: ONE!!!!!!!!!……. TWO!!!!!!!…… THREE!!!!!!!!!!!!!!!!

(DING! DING! DING!)

(“A Cut Above” by Avery Watts plays all throughout the arena as Brian Daniels is handed the New Breed Championship from the Referee as he looks at it with pride)

Announcer: The Winner of this contest by pinfall AND NNNNEEEEEWWWWWWWW NEW BREED CHAMPION!!….. BRIAAAAAAAAANNNNNNNNNNNN DANIELS!!!!….

Stew: BRIAN DANIELS WINS!! Brian Daniels has won the vacant New Breed Championship, congratulations to him!

HYC: And that means… Tyler Parker will be entering The Grand Rampage at _#1… he can’t be too happy about that!

(Camera cuts backstage to a smiling Flashback dressed in a suit and a microphone in hand)

Flashback: What a show it’s been so far here at Reckless Wiring and it’s only going to get bigger, because my guest is the man who plays a major factor in one of the contests tonight. He is a 2010 EAW Hall of Famer, a two-time World Champion, a former multi-time Hardcore Champion, former Unified Tag Team Champion! The main event! The curtain jerker! The intermission! The Golden Boy! The Bronzed Man! One of the forty people that call themselves the Greatest of All Times!

HBB: Please… Shut up.

(Camera pans to the right to reveal the Heart Break Boy; dressed in his ring attire as he looks on at Flashback)

HBB: There’s no reason for this little interview to be taking place, because ya see it’s pretty obvious what you’re going to do here. You’re gonna do your cute little schtick that you’ve done in EAW for the past who the Hell knows or cares how long and you’re going to turn this entire time into one big punchline. How about you get straight to the part where you actually DO your job and ask me the question everyone else has asked me since the very moment I stepped up to once AGAIN end the multiple personality disordered schizophrenic that everyone ignores called Mr. DEDEDE or Methuselah or whatever it is he wants to call himself. Ask me “What makes you think you can defeat Methuselah tonight?” and I’ll tell you the EXACT same thing I’ve told everyone else and that is that you are asking the wrong question to the WRONG man. You should be conducting this joke of an interview with Methuselah and you should be asking him “What makes you think you can defeat the Heart Break Boy tonight?” because that is the REAL million dollar question. I’d almost love to hear his answer to that question, but it’s already written on the wall in front of us. He’s going to do what Methuselah does and he’s going to hide between his walls of this World he lives in and he’s going to deny the fact that it was HIM laying on the ground and pinned one, two, three in that very SAME ring only two years ago. It’s a crying shame just how delusional people are when they come back for the fifteenth time and proclaim they’re some changed man and some sort of force to be reckoned with and then have the gall to challenge ME! To challenge Project E.G.O! Methuselah may have very well convinced so many that he has changed into a “monster”, but he’ll NEVER convince himself and that is something I’m going to remind him of. I’m going to remind him of that no matter how good he thinks he is, he will NEVER be as good as the Heart Break Boy! Anything he can do I can do better! I–

Voice: Anything?

(The Heart Break Boy turns around to former EAW Vixen Skyler holding a game of Dance Dance Revolution in her hands)

Skyler: C’mon, let’s see you prove it!

HBB: (no)

(The Heart Break Boy walks away as Skyler frowns)

Flashback: You know, I’m not very good at Dance Dance Revolution, but… I play a mean game of Twister. (smirk2)

Skyler (cautiously stepping back): That’s alright.. I don’t think I want to play anymore.

(Skyler walks off as a saddened Flashback looks on)

( Camera fades into the ring, ominous music begins to play as the Barbed Wire Steel Cage is lowered )

Ring Announcer: The following is a… BARBED WIRE STEEL CAGE MATCH!!

( ‘Wrong’ by Depeche Mode hits as King Catterson makes his way to the ring with the King of Extreme crown on his head )

Ring Announcer: Approaching the ring first, from United Kingdom, Shildon… weighing in at 210 pounds… HE IS THE 2013 KING OF EXTREME!!… KINGGGGGG CAAATTTTERRRRRRSSSOOOONNN!!

Stew: He’s cocky, he’s brash, he’s outspoken… but he’s one of the most talented men in EAW, and that crown on his head proves it! He feels that he’s levels ahead of the man he’s facing tonight… but there’s only one way to truly know, and we’re about to find out!

( ‘Prize Fighter’ by Grieves hits as Eddie Mack makes his way to the ring carrying the Cash in the Vault briefcase )

Ring Announcer: And his opponent, from Melbourne, Australia… weighing in at 238 pounds… HE IS THE 2013 CASH IN THE VAULT WINNER!!… EDDDDIEEEEEEEE MAAACCCCKKKKK!!

HYC: Both of these men are ensured World Championship matches in the future, and you don’t get to the point they’re at without being talented. I think Liam is out of line by saying he’s levels ahead of Eddie… could he be better? Well Stew like you said, that’s what we’re going to find out right now!

( Ding! Ding! Ding! )

Stew: The bell rings and we’re off! And folks, this is a new style of the Barbed Wire Steel Cage, generally only the top of the cage is wired, but with this type of cage… the barbed wire is woven all throughout the cage… in hindsight, you want to stay in the center of the ring as much as you can! But we all know that contact with the cage is basically inevitable. Eddie attempts to lock up with Catterson but Catterson has other ideas as he starts the match off with a kick to the mid-section. He now straightens Eddie out with a chop to the chest!

HYC: Catterson with another chop to the chest, sending a loud smacking sign through the arena… Catterson tries for a third but this one Eddie ducks under! And he sends a right hand to the head of Catterson… and now a second! Catterson trying to avoid Eddie here, but in the cage there’s limited space! Eddie throws another right hand but Catterson dodges it and now puts his own hands up… EDDIE GOES FOR ANOTHER RIGHT HAND BUT LIAM AGAIN DODGES AND NOW HE TACKLES EDDIE DOWN, HE BEGINS THROWING HIS OWN RIGHT HANDS AT EDDIE!! RIGHTS AND LEFTS TO THE HEAD!!

Stew: That’s just one of the things that makes Liam so dangerous, his ability to pick his spot… he saw an opening and took full advantage of it, that’s a major reason as to why he’s the King of Extreme right now! He eases up on the punches and gets of Eddie… allowing him some breathing room… Eddie gets to his feet… ONLY TO BE MET WITH YET ANOTHER RIGHT HAND FROM KING CATTERSON!! This one doesn’t knock him down, only staggers him… LIAM COMES CHARGING WITH A CLOTHESLINE, BUT EDDIE SIDESTEPS… GRABS LIAM AND THROWS HIM INTO THE BARBED WIRE CAGE… OH MY!!

HYC: LIAM HITS THAT CAGE AND COMES OUT, HOLDING HIS RIGHT ARM… BLOOD BEGINNING TO DRIP FROM THE ARM HERE AS EDDIE GRABS THE INJURED ARM AND TWISTS IT AROUND THE BODY OF LIAM!! AND NOW EDDIE LOOKS TO PUSH LIAM INTO THE CAGE… BUT LIAM WITH HIS FREE ARM ELBOWS EDDIE IN THE SIDE OF THE HEAD… GETTING HIM TO RELEASE THE ARM!! AND NOW LIAM FROM BEHIND FORCES EDDIE INTO THE CANVAS WITH A REVERSE BULLDOG!! HE ROLLS EDDIE OVER AND GOES FOR THE PIN!!

ONEEE!!… TWOOO!!… NO EDDIE WITH THE KICKOUT!!

Stew: With that pinfall, it’s crucial we inform you about the ways you can win the match. You can win by one of four ways, pinfall, submission, climbing the cage… though with the barbed wire I can’t imagine you wanting to. The fourth way is to escape the door… which Liam might be going for here as he motions towards the referee! THE REFEREE UNLOCKS THE DOOR AND OPENS IT… BUT EDDIE TO HIS FEET KNOCKS LIAM OFF HIS BEFORE HE COULD REACH THE DOOR AND THE REFEREE CLOSES IT AND LOCKS IT BACK UP!!

HYC: Eddie pulls Liam into the center of the ring… and drops an elbow across the arm that went into the steel cage! And it seems like Eddie’s agenda is clear… he’s going to target the right arm of Liam… and if Eddie can immobilize that arm, that would be HUGE because that would take both the Cutterson and the Catterson Impact out of Liam’s arsenal! Eddie now holds Liam’s arms in place… HE THRUSTS BOTH KNEES UP INTO THE AIR AND DRIVES THEM BACK DOWN INTO THE ARM OF LIAM AS THE KING OF EXTREME LETS OUT A BIG SCREAM!!

Stew: Eddie again grabs Liam’s arm, but Liam swings around his other arm catching Eddie in the temple… Liam now gets to his feet, Eddie still shaken from the hit to the head… LIAM COMES CHARGING AND LANDS THE FAME-ASSER!! PLANTING EDDIE HEAD FIRST INTO THE CANVAS!! EDDIE CRAWLS OVER TO THE ROPES AND USES THEM TO GET BACK TO HIS FEET… BUT OH MAN!! LOOK AT LIAM!! OH MAN!! LIAM PUSHES EDDIE INTO THE CAGE!! INTO THE BARBED WIRE CAGE!! EDDIE GOES FACE FIRST INTO THE CAGE MY GOD!!

HYC: EDDIE HITS THE CAGE AND FALLS TO HIS KNEES… NOT EVEN BOUNCING BACK… AS IF THE BARBED WIRE IS STILL ATATCHED TO HIS SKIN… AND NOW LIAM STICKS HIS BOOT IN THE BACK OF EDDIE’S HEAD… AGAIN FORCING IT INTO THE BARBED WIRE MY LORD!! EDDIE IN OBVIOUS PAIN HERE AS LIAM APPLIES MORE FORCE… GRABBING ONTO THE ROPES EVEN, PUTTING ALL HIS POWER NITO IT!! Liam finally releases the pressure… Eddie falls to his back, his face bloody red… as is the area of the cage where his head was just a moment ago…

Stew: Liam now drops an elbow across the chest of Eddie… and now a second one, and a third… a fourth! AND NOW A BIG FIFTH ELBOW TO THE CHEST!! AND LIAM IS IN THE DRIVERS SEAT HERE… HE STALKS EDDIE FROM BEHIND AS HE GETS TO HIS FEET… EDDIE UP, TURNS AROUND AND LIAM CHARGES AT HIM… LIAM LEAPS HIGH INTO THE AIR BUT EDDIE SIDESTEPS IT AND LIAM CRASHES INTO THE CAGE!! NOT GOOD!! AND NOW EDDIE WITH A DROPKICK TO LIAM’S BACK… PUSHING HIM INTO THE CAGE AGAIN… AND NOW IT’S TIME FOR A LITTLE PAYBACK AS EDDIE GRABS THE HEAD OF LIAM AND STARTS MOVING IT BACK AND FORTH ACROSS THE CAGE!!

HYC: EDDIE MACK IS LITERALLY SHREDDING THE FACE OF LIAM CATTERSON, THE MILLION DOLLAR FACE OF KING CATTERSON IS BEING RUINED HERE AND EDDIE MACK IS ENJOYING EVERY SINGLE MOMENT OF IT!! EDDIE WITH A QUICK ELBOW TO THE BACK OF THE HEAD BEFORE HE SHREDS IT AGAINST THE CAGE ONCE MORE… AND NOW ANOTHER ELBOW, FOLLOWED THE SHREDDING ACROSS THE BARBED WIRE… EDDIE DOES THIS SEQUENCE TWO MORE TIMES BEFORE DROPPING LIAM TO THE CANVAS!! Eddie now drags Liam towards the center and grabs his legs… OH NO!! DON’T TE—YES!! EDDIE SLINGSHOTS LIAM RIGHT BACK INTO THE CAGE!! LIAM COMES STUMBLING OUT… AND NOW GETS PLANTED WITH A DDT!! A HUGE DDT BY EDDIE MACK AS HE HEADS INTO THE COVER!!

ONEEE!!… TWOOO!!… THRR—NO!! LIAM KICKS OUT!!

Stew: And this is what Eddie needs to do more often, Chico! One of Eddie’s biggest problems is that he doesn’t show his aggressive side much, but he certainly has one as shown there… Eddie sits Liam up… AND HE DISHES OUT A HUGE KICK TO THE SPINE!! WOW WHAT A SOUND THAT MADE!! LIAM’S BLOOD SOAKED EYES WINCE AND HE GRITS HIS TEETH… JUST AS EDDIE LEASHES OUT A SECOND ONE!! Liam trying to get back to his feet here… AND OH MY!! FROM OUT OF NOWHERE EDDIE MACK CONNECTS WITH THE EGO TRIP!! THAT HUGE UPPERCUT KNOCKS LIAM RIGHT BACK DOWN TO THE CANVAS… HE HOOKS THE LEG!!

ONEEE!!… TWOOO!!… THR—NO!! LIAM AGAIN MANAGES TO GET THE SHOULDER UP!!

HYC: Eddie sits himself up, wipes some blood from his face, both men at this stage of the game have lost a lot of blood… Eddie to his feet here… and I think he’s looking to wrap this one up… he lowers himself down to a squatting position, measuring up Liam Catterson who’s staggering to his feet, still obviously dazed from that MASSIVE uppercut delivered just moments ago.. Liam up and now he turns around… EDDIE LEAPS UP LOOKING TO DELIVER FOR HEAVEN’S SAKE!! FHS!! BUT NO!! LIAM CATCHES HIM AND THROWS HIM INTO THE TURNBUCKLE!! AND HE FOLLOWS THAT UP WITH A SUPERKICK!! A SUPERKICK TO EDDIE MACK WHO COLLAPSES!!

Stew: The momentum caused Liam to fall as well but he quickly regains himself and begins slowly limping over to the ropes… He reaches the turnbuckle and begins to back himself up it… BUT UH OH LOOK!! EDDIE MACK WHO WAS ON HIS KNEES, REALIZED LIAM MAKING HIS WAY TO THE TOP, SO NOW HE MAKES HIS WAY OVER TO THE CORNER AS WELL!! LIAM FINDS HIMSELF AT A CROSSROADS HERE… HE CHOOSES TO CLIMB THE CAGE!! THE BARBED WIRE CAGE!! I’M SURE THE WIRE IS DIGGING INTO HIS HANDS AND FINGERS, BUT IF HE WANTS TO ESCAPE EDDIE THIS IS THE ONLY WAY!!

HYC: EDDIE NOW DOES THE SAME!! BEGINNING TO CLIMB AS WELL, CHASING AFTER LIAM CATTERSON!! LIAM MAKES IT TO THE TOP… BUT NOW THE REAL STRUGGLE BEGINS, TRYING TO AVOID THE MASSIVE AMOUNT OF BARBED WIRE AT THE TOP!! LIAM TRIES TO SEND HIS LEG OVER THE CAGE BUT IT GETS CAUGHT IN THE BARBED WIRE SO HE PULLS IT BACK… AND NOW LOOK AT EDDIE!! OH MY GOOD LORD LOOK AT EDDIE!! HE’S CAUGHT UP WITH LIAM… AND NOW HE GRABS AHOLD OF HIM… OH GOD NO!!

Stew: LIAM IS LITERALLY HANGING ON FOR DEAR LIFE HERE FOLKS… BUT BAH GAWD!! EDDIE WITH A BACK SUPERPLEX FROM THE TOP OF THE CAGE!! BOTH MEN CRASHING TO THE MAT!! MY GOD WHAT A MOVE BY EDDIE!! IT LAYS BOTH MEN OUT… BUT LOOK AT EDDIE!! EDDIE RAISES HIS ARM AND LAYS IT ACROSS THE CHEST OF LIAM!!

ONEEE!!… TWOOO!!… THREEE!!

( Ding! Ding! Ding! )

( ‘Prize Fighter’ hits as the cage rises and Eddie very slowly gets to his feet )

Ring Announcer: Your winner… EDDDIEEEEEEEE MMMACCCCKKKK!!

Stew: And by pulling off a risky and painful, yet rewarding Back Superplex from the top of the cage, Eddie Mack comes out victorious in this very, very brutal Barbed Wire Steel Cage Match

HYC: This is a HUGE win for Eddie Mack here at Reckless Wiring, it gives him a lot of momentum heading into the weeks and months ahead. Congratulations to him.

(Camera cuts backstage to Prince of Phenomenal in his ring attire as he readies himself for his upcoming contest… A knock at the door is heard)

POP: What do you want?

(Max cracks open the door)

Max: I was wondering if I could… Get an interview in with you before your big match?

POP: … Yeah, sure, whatever.

Max: Are you decent? I can’t tell from here.

POP: Just come in.

(Max cautiously enters the room as he looks around to see POP is the only one around)

Max: Where’s everyone else?

POP: I don’t know and I really don’t care. Tonight isn’t about Project E.G.O, it’s obviously not about that. Cleopatra, the Heart Break Boy, they’re both doing who
knows what right now while Jaywalker remains comfy on his little winning streak or whatever it is. They’ve all become selfish, so how about I join the trend? The only person that matters right now is myself. And I’m going to do what Project E.G.O does and I’m going to win BACK MY Answers World Champion that the paper Champion, Y2Impact, never defeated me for.

Voice: I’m ready!

(Christy Cruise steps out of the small dressing room area to reveal her Referee outfit for the evening)

POP: Great. Now you know the number one rule tonight?

Christy: Uhm… That Impact doesn’t leave with the Answers World Title belt?

POP: No, Christy, that would be a fact. The number one rule tonight is do NOT get in my way. Max, I think our time is up…. Max?

(Prince of Phenomenal turns to a Max drooling as he hypnotically stares at Christy Cruise)

Christy: Oh God…

(POP immediately grabs a hold of Max and slams him up against the lockers as Max is snapped back to reality)

POP: I said we’re out of time. However… I’ll say one last thing. Last Dynasty I said it would take an “Act of God” for Impact to win, right?

(Max cautiously nods)

POP: Then consider this match as one-sided as it gets, because how can there be such a thing as divine intervention when we’ve already LONG since edged God out? Think about it.

(POP’s expression turns to a sadistic smile as he lets Max go.. Max runs away as POP speaks again with Christy Cruise)

(Camera transitions to Y2Impact in his locker room in his ring attire and a new jacket as he stretches before his match with the Answers World Championship laid upon a bench in front of him)

(Y2Impact picks up the Answers World Championship and places it on his right shoulder as he makes his way out of the locker room… Only to stop as he meets eyes with Methuselah, standing just outside of the locker room)

(Methuselah’s expression turns to a smirk as Y2Impact’s expression shifts to a smirk as well… Y2Impact’s expression turns to a more serious demeanor as he steps passed Methuselah and continues on his way)

(Video package plays of the feud between Y2Impact and Prince of Phenomenal for the Answers World Championshipl; featuring their back and forth attacks on one another.. Y2Impact brutally assaulting Troy Conway and Christy Cruise while POP looks on.. And the added stipulation of the fans voting for either Troy or Christy to be the Special Guest Referee for the contest)

(Camera fades to the ring)

(“Mercy” by Kanye West plays all throughout the arena as Christy Cruise makes her way out to the stage in a Referee uniform with a devious smile upon her face)

Stew: Well it’s no secret by any means that Project E.G.O is out to get the Champion in this contest that has turned from simple business to quite personal over the past couple months, but that may very well be Impact’s fault after he let his rage get the better of him and attacked the young lady making her way down to the ring in the former Vixens Champion, Christy Cruise.

(“If I Had a Heart” by Fever Ray plays all throughout the arena as Prince of Phenomenal makes his way out to the stage in blue and silver ring attire with a custom jacket reading “Project P.O.P” on the back)

HYC: Prince of Phenomenal has made it known that tonight he is only in it for himself, claiming he’s just following the trend of he and Christy’s alliance of Project E.G.O as he has become more and more obsessed with reclaiming his Answers World Championship. POP knows the odds are greatly in his favor and judging from the look of confidence on his face, he may already think he’s won this.

(The arena goes pitch black except for the titantron as a countdown appears)

5…

4…

3…

2…

1…

(“Twisted Transistor” by Korn plays all throughout the now lit-up arena as Y2Impact stands in his signature pose with his usual attire and a black and silver jacket with flashing yellow lights on the spine reading “Y2I”.. Y2Impact spins around with a serious look on his face and the Answers world Championship around his waist)

Stew: You’ve got to hand it to the reigning Answers World Champion, even despite all of the odds against him and the fate of this contest in the hands of an enemy in Christy Cruise, he still shows off like no other! Impact is looking as flashy as ever as he makes his way down to the ring and slides in to go straight for POP! Christy stops Impact as she gets between the two men..

(Y2Impact’s music stops as Christy Cruise demands Y2Impact back up)

Announcer: The following contest is scheduled for ONE fall… And it is for THE ANSWERS CHAMPIONSHIP OF THE WOOOORRRLLLD!!…. First, the challenger…. From Miami, Florida!…. Weighing in at 214 pounds!…. PRINCE! OF!! PPPPPHHHHHHHHHHHEEEENNOOOMMMEEENNNAAALLL!!!….

(POP quickly takes off his jacket and tosses it to the outside as the crowd erupts with boos)

Announcer: And his opponent…. From Seattle, Washington!…. Weighing in at 226 pounds!…. HE IS THE REIGNING ANSWERS WORLD CHAMPION!!…. Y! TWO!! IMMMMMMPPPPPPAAAACCCTTTTT!!!….

(Y2Impact raises his Answers World Championship proudly in the air from his corner before reluctantly handing it to Christy Cruise)

(DING! DING! DING!)

Stew: Christy Cruise has immediately called for the bell–AND THESE TWO GENTLEMEN WASTE NO TIME GOING AT IT! Lefts and rights are flying all over the place as POP and Impact have erupted into this brawl that only a boiled-over personal hatred of this magnitude can spawn!! Neither of these men is allowing the other to gain any sort of control in the early going as this has quickly been thrown away as any sort of wrestling match, but instead a FIGHT and a fight between two men that have wanted to beat the hell out of one another for quite a while! POP may very well be gaining the upper-hand here as Impact is slowly being driven into the nearest corner despite the seemingly even match up between both men! Impact immediately catches POP off-guard by grabbing the back of his head and switching places with his opponent as POP is driven into the corner instead! Impact charges in with a full head of steam! Corner elbow! POP’s got it scouted as he nails Impact with a powerful kick right into the side of his opponent! Impact is sent reeling into the middle of the ring..

HYC: POP CHARGES! IMPACT CATCHES POP BY HIS LEGS AND DROPS HIM FLAT ON HIS BACK!! HE’S LOOKING FOR THE WALLS OF IMPACT!!! WALLS OF IMPACT ARE NEARLY LOCKED IN AS POP IS STRUGGLING!! Christy Cruise is immediately intervening as she tries to pull Impact off of the downed Prince of Phenomenal! Impact lets go of one of POP’s legs.. And uses his free hand to force Christy away, sending her into the ropes! POP seizes the opportunity as he NAILS Impact with a heel kick to the mid-section! Impact doubles over in pain.. POP follows up with a second heel kick as it bounces off of the side of Impact’s skull this time! POP isn’t anywhere near finished as he continues the onslaught of heel kicks repeatedly into the skull of the Answers World Champion!! Impact is grounded and could very well be unconscious after that assault!

Stew: POP might be more sure of that than anyone else as he rushes as quickly as possible to Impact’s motionless body as he forcefully rolls his opponent onto his back! POP HOOKS THE LEG OF IMPACT AS CHRISTY RUSHES OVER TO COUNT THE FALL!!

Christy: ONE! TWO!! THREE!

HYC: IMPACT WITH A KICK OUT! What a VERY close call, but that’s to be expected from Christy Cruise as she is as intent as ever to guarantee Impact a loss and send the Answers World Title back to the hands of Prince of Phenomenal, but Impact is as resilient as they come and he’s proving that in this glorified handicap match as POP mounts himself atop the back of Impact and wastes no time sending several blunt shots across the back of the downed Champion’s skull! Impact is in a lot of trouble here and it doesn’t look like the situation is going to improve anytime soon as POP is just unrelenting in this attack! POP has a possessed look in his eyes and that’s something we’ve seen regularly from him since he first began this crusade of his to retrieve the Answers World Championship he lost back in October and he could very well be on the verge of succeeding as he lays into Y2Impact without mercy! LOOK AT THIS! IMPACT’S ACTUALLY PUSHING THROUGH THE PAIN TO POSSIBLY POWER OUT OF THIS! Impact is showing an incredible amount of strength right now, because despite the damage he’s accumulated he’s ACTUALLY attempting to pick POP up!!

Stew: Don’t downplay Impact’s showing of strength here, this is unorthodox to say the least as Impact is looking damn-near SUPERHUMAN as he pulls himself to his feet with POP firmly mounted on his back! POP is as surprised as anyone else! POP sends one more devastating blow to the back of Impact’s skull to send him faltering! IMPACT FORCES HIMSELF TO HIS FEET AND DRIVES BOTH MEN INTO THE NEAREST CORNER! Christy about got herself caught up in that one as she just barely dodges out of the way! Impact is in a lot of pain right about now as he manages to hold himself up by the top rope, but this moment of glory may not last long as POP swings! Impact anticipates it as he clocks POP with a powerful elbow! Impact manages to drive a second elbow into the unguarded face of POP! Impact is using whatever he has left in his tank as he sends several more identical elbows into his opponent!! Impact is looking fired up!

HYC: Prince of Phenomenal seems to now be the one in trouble here as Impact seems to have caught a second wind! Makes his way out of the corner as POP’s just barely got himself propped up.. Impact almost immediately thrusts himself forward with a corner clothesline to POP as a worried Christy Cruise looks on in dismay! POP is on spaghetti legs right about now as he woozily steps forth from the corner.. Impact is looking gassed after the damage he’s taken thus far, but he seems to be pulling through as he could be looking to capitalize.. STEP-UP ENZUIGIRI CONNECTS!! It seems as though Impact isn’t the only one of these two competitors that has a great amount of resilience in him as POP is NOT done just yet as he barely props himself up upon the middle rope with a glazed over look in his eyes! Both of these men have withheld absolutely NO punches thus far as they both seem to have put one another in an immense amount of pain as Impact’s back to his feet.. IMPACT CHARGING!!

Stew: UP AND OVER GOES IMPACT AS POP JUST BARELY COUNTERS INTO A BACK BODY DROP!! Look at this though, it’s not enough as Impact easily catches himself on the ring apron! POP didn’t seem to have enough energy in him to get all of it and he may pay for it right now as Impact nails POP with a crossface shot from behind! Impact grabs a dazed and confused Prince of Phenomenal and navigates him with a quickly gaining amount of momentum! POP is sent colliding face-first into the nearest top turnbuckle as he falls flat on his back like a damn statue! Impact is fully in control now and there’s no argument about it! Impact could possibly be looking to put an end to this contest right here and now as he goes up to the top turnbuckle and that is most definitely a place he is not accustomed to and it could either make or break him in this contest as it seems he’s got POP right where he wants him! IMPACT IS PERCHED! IMPACT DROPS GROIN-FIRST ONTO THE TOP TURNBUCKLE!

HYC: Impact is caught completely off-guard by the Special Guest Referee for this contest in Christy Cruise intentionally slamming into the top rope and forcing the Champion to lose his balance! Impact is once again feeling the effects of this two-on-one mentality these fellow Project E.G.O members have here with the determination to end his reign tonight! Christy is begging for POP to get up as POP finally shows some signs of life… POP is clearly feeling the damage dished out by Impact, but he’s slowly coming to his senses as he stumbles back to his feet.. Christy helps POP back up now.. POP stumbles forward and nails Impact with a closed-fist shot straight to the skull! POP is looking to make a comeback here and he may succeed with the Referee on his side as he climbs up to meet Impact on the top turnbuckle… POP connects with another powerful shot to Impact before setting him up! POP LOOKING FOR A SUPERPLEX HERE!! THIS IS IT! No–Impact is fighting it with all of his might! Impact is refusing to let it end here! Impact with several unforgiving blows into the ribs of POP!

Stew: POP FALLS BACK DOWN TO THE CANVAS!! Impact immediately goes to work on regaining his balance as a dazed POP uses the force of the fall to roll himself back up to his feet, but just barely as Impact is in the driver’s seat! IMPACT LEAPS!! FLYING CROSSBODY!!! CORONA KICK!!!! POP CONNECTS WITH THE CORONA KICK OUT OF THE BLUE AS BOTH MEN ARE LAID OUT UPON THE CANVAS!!! POP MAY HAVE JUST COMPLETELY TURNED THIS MATCH AROUND! LOOK AT THIS!! CHRISTY IS DRAGGING POP OVER TO IMPACT’S DOWNED BODY!! CHRISTY IS STRUGGLING, BUT SHE’S DOING IT… SHE… SHE DRAPES POP’S ARM OVER THE CHEST OF IMPACT AND COUNTS IT! NOT LIKE THIS! DAMN IT NOT LIKE THIS!!

Christy: ONE!! TWO!! THRE–

HYC: IMPACT WITH A SHOULDER UP!! HE’S GOT A SHOULDER UP!! CHRISTY CAN’T BELIEVE IT! The resilience of the Answers World Champion is unnatural! Impact must subconsciously know he REFUSES to stay down for anything that these E.G.O comrades can dish out and he’s doing just that! Christy is furious as she’s egging on POP to get back up and finish the job… POP is still looking dazed, but he’s pulling through the pain and agony at the hands of his opponent as Christy slowly helps him back to his feet.. POP wastes no time looking to end this as he grabs a hold of Impact, slowly dragging him back to a vertical base… He–IMPACT SPRINGS TO HIS FEET! CODEBREAKER!!!! THE CODEBREAKER OUT OF NOWHERE!! BOTH MEN ARE DOWN ONCE MORE!!! POP is sent rolling towards the ropes as a still damaged Impact immediately shows signs of life, trying to crawl towards his downed opponent… WHAT?! CHRISTY PUSHES POP TO THE OUTSIDE!! POP falls to the outside as Impact can’t believe it!

Stew: Christy’s suddenly playing innocent now as if she’s done nothing wrong! Impact slowly pulls himself back to a vertical base.. Making his way towards Christy! Christy isn’t having it as she gets in the face of Impact, throwing around her authority! IMPACT HAS HAD ENOUGH AS HE DROPS CHRISTY FLAT ON HER BACK AND GRABS HER LEGS!! WALLS OF IMPACT!!!! THE WALLS OF IMPACT ARE LOCKED IN ON CHRISTY CRUISE!!! CHRISTY’S PANICKING AS HER BODY IS CONTORTED AT THE HANDS OF THE CHAMPION!! POP COMES OUT OF NOWHERE AS HE DRIVES IMPACT INTO THE RINGPOST IN THE NEAREST CORNER!! POP seems to have caught HIS second wind in this contest as he seems to be shaking the cobwebs out despite the devastating Codebreaker he just ate moments ago! POP is visibly in pain, but he couldn’t care less as Impact drops to the outside… POP follows suit as he pushes the timekeeper down and takes his chair! Impact’s struggling to get back up..

HYC: POP DRIVES THAT CHAIR ACROSS THE SPINE OF IMPACT!! Impact isn’t giving up just yet, but POP sends a second unforgiving shot to the spine with that chair!! Look at the resilience of the Champion as he’s doing everything he possibly can to keep himself up, even using the barricade on the outside to aide him! Impact’s firmly on his feet! Impact immediately turns around TO MEET A THIRD SHOT TO THE SKULL WITH THAT CHAIR, COURTESY OF POP!! The Answers World Champion is DOWN! POP’s got that demonish look in his eyes as he rips off the cover of both the Spanish announce table and our announce table, looking for something decisive I’m sure! POP drags Impact back to his feet.. And rolls him atop our table!

Stew: POP has climbed up there with Impact and this is exactly where you DON’T want to be as Impact is pulled in… POP SIGNALS THE END!! WHAT’S HE.. MIAMI SUNRISE ONTO THE SPANISH ANNOUNCE TABLE!!!! NO! NO IMPACT SOMEHOW LANDS ON HIS FEET!! THAT TABLE MAY VERY WELL COLLAPSE! IMPACT’S GOT THE LEGS OF POP, BUT HE’S STRUGGLING!! IMPACT… SLINGSHOT!!! IMPACT SENDS POP FLYING OVER THE BARRICADE AND INTO THE CROWD AREA WITH A SLINGSHOT!!! POP CRASHES WITH GREAT FORCE UPON THE CEMENT!! Impact is laid upon the Spanish table and his chest is heaving with every breath he can muster, but he KNOWS he has to end this as he rolls off.. Impact makes his way towards the barricade, grabbing a hold of the downed POP and slowly pulls him back to a vertical base… POP is sent back over the barricade by the Champion!

HYC: It seems the end is near as Impact slowly navigates POP towards the ring… Impact sends POP rolling back in the ring! Impact slides in, possibly looking to end this!! Wait.. Where’s Christy Cruise gone? CHRISTY NAILS IMPACT WITH A SHOT TO THE BACK OF THE SKULL WITH THE ANSWERS WORLD TITLE OUT OF NOWHERE!!! IMPACT IS DOWNED POP COVERS HIM!! THIS HAS GOTTA BE IT!!

Christy: ONE!!!! TWO!!!!! THREE!!!

Stew: KICK OUT!! KICK OUT! IMPACT WITH A KICK OUT AS POP AND CHRISTY CANNOT BELIEVE IT!! POP has erupted with frustration as he demands the Answers World Championship! POP swipes the Title from Christy’s hands and yells at her to pick Impact up! Christy struggles… But she’s slowly bringing Impact back to his feet! Impact is in trouble!! CHRISTY’S GOT HIM UP!! POP SWINGS AS IMPACT DODGES!!! CHRISTY TAKES THE BELT TO THE FACE AS SHE’S SENT FALLING THROUGH THE ROPES AND TO THE OUTSIDE!!! POP realizes the mistake he’s just made as he looks on at the downed Christy Cruise! IMPACT WITH A SCHOOL BOY ROLL-UP FROM BEHIND! NO, IMPACT CHANGES DIRECTIONS AS HE’S GOT BOTH LEGS OF POP!! HE’S LOOKING FOR IT!! WALLS OF IMPACT!!!! IMPACT’S GOT THE WALLS LOCKED IN!!! POP IS STRUGGLING, GRABBING A HOLD OF THE ROPES!!! Impact drags POP into the middle of the ring!! LOOK AT THIS!!

HYC: A NEW OFFICIAL MAKES HIS WAY OUT HERE NOW AS POP LOOKS ON IN DISMAY!! POP REALIZES HE’S IN MORE TROUBLE THAN EVER AS IMPACT INCREASES THE PRESSURE!! POP’S AIMING FOR THE ROPES!! HE TAPS!! HE TAPS! POP TAPS OUT!!

(DING! DING! DING!)

(“Twisted Transistor” plays all throughout the arena as Y2Impact falls back and grabs his Answers World Championship off of the canvas)

Announcer: The Winner of this contest by submission!!…. AND STILL ANSWERS WORLD CHAMPION!!!….. Y! TWO!! IIMMMMMMMMMMPPPPPPPPAAAAAACCCCTTT!!!!….

Stew: AND IMPACT, AGAINST SEEMINGLY ALL ODDS RETAINS THE ANSWERS WORLD CHAMPIONSHIP!! I don’t believe it Chico, I really don’t! I would’ve placed my money, ALL MY MONEY, EVERY CENT I OWN ON POP TONIGHT! I think everyone thought, though may not have said, that POP was going to become the new Answers World Champion!

HYC: I’m shocked too… Impact had everything heading into this match and STILL COULDN’T get the job done! Congratulations to Impact, giving it all tonight… and it certainly showed.

( Camera transitions backstage and shows a split-screen of both Methuselah and The Heart Break Boy walking out of their locker rooms )

Stew: Well folks, business is about to pick up, the main event is next…

( A video package of the Methuselah/Heart Break Boy begins to play. It shows the formation of Project E.G.O., Methusleah’s return at the EAW Awards Show, The Heart Break Boy calling out Methuselah and the Contract Signing between the two. The package ends with Methuselah getting Superkicked and The Heart Break Boy standing over him )

( Camera fades to the ring announcer )

Ring Announcer: The following contest is scheduled for one fall! If The Heart Break Boy loses, he must disband Project E.G.O. and they can never interact with one another again! Should Methuselah lose then he must leave Extreme Answerz Wrestling for good and under no circumstances can he ever return!

( ‘New God Flow’ by Kanye West and Pusha T hits as The Heart Break Boy makes his way to the ring, midway down the ramp he drops to his knees as a huge blast of pyro goes off )

Ring Announcer: Approaching the ring first, from Chicago, Illinois… weighing in at 220 pounds… THEEE HEARRRRTTTTTTT BRRRREEEAAAAKKKKKKK BOOOOOYYYYY!!

Stew: He’s been world champion, he’s headlined Pain For Pride… he’s done it all in this company, he’s even beat Mr. DEDEDE at this event, two years ago! The big question however is… can he do it again? Can he do it again with Methuselah’s career on the line? Will if he can’t his group Project E.G.O. will be forced to disband. And in my opinion, no matter which way you try to flip it… the stakes have never been higher.

( The lights dim, smoke starts to fill the ringside as ‘Monster’ by Kanye West hits, Methuselah emerges from the smoke and makes his way to the ring wearing his signature black trench coat )

Ring Announcer: And his opponent, from Parts Unknown… weighing in at 230 pounds… METTTTHHHUUUSSSELLLLLAAAAAHHHHH!!

HYC: Even with all the pressure on HBB, the pressure on this man must be doubled. If he loses tonight then that’s it, I don’t know if you realize this folks, if Methuselah doesn’t win tonight… he’s gone, gone for good… we WILL NEVER, EVER SEE HIM AGAIN! Both these men know what’s on the line here tonight, we’re in for a bona fide battle tonight!

( Ding! Ding! Ding! )

Stew: There’s the bell… the two men lock eyes and begin circling the ring, with so much at stake there is no doubt this will be a FIGHT! Stone expressions on both men… they close in on each other and lock horns… HBB THROWS THE FIRST SHOT AT METH!! A SWIFT RIGHT HAND CATCHING HIM IN THE TEMPLE… METH FIRES BACK WITH A SIMILAR SHOT AND HERE WE GO!! THEY BEGIN TRADING SHOTS… EXPLOSIVE LEFT’S AND RIGHT’S!! METHUSELAH GETTING THE BETTER OF THE HEART BREAK BOY HERE… METH GOES FOR A HUGE RIGHT HAND, BUT HBB DUCKS UNDER AND SLIDES OUT OF THE RING TO BUY HIMSELF SOME TIME!!

HYC: Smart move by HBB… although to the dismay of the fans, there’s nothing wrong with taking a break, recalibrating your plan and clearing your head… OH BUT LOOK AT METH!! METH LAUNCHES HIMSELF OVER THE ROPES AND DIVES ON TOP OF THE HEART BREAK BOY!! AND NOW HE CONTINUES WITH THOSE SHOTS… EACH ONE DELIVERED WITH PURPOSE!! EACH ONE PERHAPS HELPING SAVE METH’S CAREER!! Meth gets off HBB and motions towards the ring, he pulls up the apron… AND HE PULLS OUT A KENDO STICK!!

Stew: Meth moves towards HBB with that kendo stick… HE LIFTS IT HIGH ABOVE HIS HEAD!! BUT HBB GRABS METH AND FLAPJACK’S HIM STOMACH FIRST OVER THE BARRICADE!! HBB NOW LIFTS UP THE KENDO STICK… AND LASHES IT ACROSS THE BACK OF METHUSELAH!! AND NOW HE DOES IT A SECOND TIME!! AND NOW HBB GOES ON A FRENZY WITH THAT KENDO STICK!! LASHING IT ACROSS THE BACK FIVE… TEN… FIFTEEN TIMES, COMPLETELY SHREDDING IT TO PIECES!! AND NOW HE FLIPS METH OVER THE BARRICADE, AND INTO THE STANDS!! HBB NOW FOLLOWS AND LIFTS METHUSELAH TO HIS FEET AND THROWS A HARD RIGHT HAND!! CAUSING METHUSELAH TO STUMBLE BACK AS THEY START UP THE STAIRS!!

HYC: Methuselah having trouble staying on his feet here… HBB with yet another right hand! This one brings Methuselah down, but he quickly grabs ahold of a fan’s chair to get himself back up! HBB tries for another, but this time Meth ducks… under the shot… AND NOW HE THROWS A RIGHT AT HBB!! MY GOD WHAT A SHOT!! KNOCKING HIM SQUARE OFF HIS FEET!! HBB NOW TRYING TO ESCAPE METHUSELAH, BUT WHERE DOES HE GO?! THEY’VE REACHED THE TOP OF THE FIRST LEVEL!!

Stew: BUT LOOK AT HBB!! HE GRABS AHOLD OF THE RAILING AND PULLS HIMSELF OVER INTO THE SECOND LEVEL OF THE ARENA!! METH NOW FOLLOWS AND IT’S LIKE A CHASE!! HBB GOING THROUGH THE CROWD, HOPPING OVER SEATS, TRYING TO DO EVERYTHING HE CAN TO ESCAPE THE GRASP OF METHUSELAH WHO FOLLOWS RIGHT BEHIND, JUST OUT OF REACH!! HBB NOW HAS REACHED THE TOP OF THE SECOND LEVEL… BUT HE GRABS ONTO THE RAILING AGAIN AND PULLS HIMSELF OV—WAIT NO!! METH CAUGHT HIM!! METH CAUGHT HIM AND HAS HIM IN A POWERBOMB POSITION… OH MY!!

HYC: BUT HBB GRABS BACK ONTO THE RAILING AND USES THE SHOULDERS OF METHUSELAH AS EXTRA LEVERAGE TO PULL HIMSELF BACK OVER THE RAILING, REACHING THE NEXT LEVEL!! METHUSELAH NOW DOES THE SAME!!… PULLING HIMSELF OVER THE RAILING ONTO THE THIRD LEVEL… THE LAST LEVEL!! HBB HAS ALREADY GOTTEN A GOOD HEADSTART ON METHUSELAH… BUT WHERE CAN HE GO… THE NEXT LEVEL WOULD BE THE BOX SEATS… BUT IT’S IMPOSSIBLE TO REACH THEM!… HBB’S RUN INTO A DEAD END AND METHUSELAH IS HOT ON HIS TRAIL!!

Stew: HBB REACHES UP… BUT HE’S JUST OUT OF REACH OF THE BOX SEATS!! HE TRIES TO CLIMB IT… STILL NO USE!! AND LOOK OUT!! METHUSELAH FROM BEHIND WITH A BLOW TO THE BACK!! HBB FIGHTS BACK… WITH A RIGHT HAND, STILL TRYING TO FIND AN ESCAPE ROUTE BUT THERE ISN’T ONE!! THERE ISN’T ONE IN SIGHT!! AND NOW HE GETS LEVELED WITH A BOOT TO THE FACE BY METH!! METH GETS HIM BACK TO HIS FEET AND RAMS HIM INTO THE WALL OVER AND OVER AGAIN, SPINE FIRST!! HBB CRINGING IN PAIN AS HE RAMS HIM INTO THE BIG WALL YET ANOTHER TIME BEFORE LETTING HIM DROP TO THE FLOOR!!

HYC: Meth grabs HBB by the hair and begins pulling him towa—OH NO!! OH NO!! METH PULLING HBB TO THE EDGE OF THE TOP ROW!! DON’T TELL ME HE’S GOING TO THROW HBB OVER!! SENDING HIM PLUMMETING ALL THE WAY TO THE BOTTOM!! THEY’VE REACHED THE END!! THE ONLY THING THAT SEPERATES HBB FROM A 60 FOOT FALL IS A FOUR FOOT GUARD RAIL!! METH PULLS HBB UP AND SENDS HIM OVER!!…. WAIT NO!! HBB KICKING HIS LEG BACK INTO THE GROIN OF METHUSELAH… AND FOLLOWS THAT UP WITH AN ELBOW TO THE JAW!! AND NOW HBB GRABS METHUSELAH BY THE HEAD.. AND HE… AND HE… OH MY GOD!!

Stew: HE SENDS METHUSELAH OVER THE RAILING, HE—HE HOLDS ON!! METHUSLEAH HOLDING ONTO THE RAILING FOR DEAR LIFE HERE… IF HE LET’S GO A 60 FOOT DROP AWAITS HIM!! HBB SCRATCHING, CLAWING, AND POUNDING AWAY AT THE HANDS OF METH, TRYING TO LET HIM LET GO BUT METH’S HOLDING ON LITERALLY FOR DEAR LIFE HERE!! BUT HBB… HBB FORCES THE RIGHT HAND AWAY FROM THE RAILING… METHUSELAH TRYING TO HANG ON… BUT HBB WITH A SHOT TO THE FACE… AND IT FORCES METHUSELAH TO LOSE GRIP OF THE RAILING!!

HYC: AND METHSUELAH TAKES THE FALL!! MY GOD THE 60 FOOT FALL ALL THE WAY TO THE BOTTOM!!…

Stew: WAIT NO CHICO… LOOK!! METHUSELAH CAUGHT HIMSELF ON A PLATFORM JUST TEN FEET DOWN!! AND LOOK THESE PLATFORMS CONTINUE THEIR WAY DOWN THE ENTIRE SIDE!! METHUSELAH DROPS DOWN TO THE SECOND PLATFORM… AND NOW THE THIRD… CONTINUING HIS WAY DOWN THE SIDE OF THE ARENA… AND HBB IS COMPLETELY UNAWARE OF THIS BECAUSE WHEN HE DELIVERED THE RIGHT HAND TO METHUSELAH, HE COLLAPSED BACKWARDS IN EXHAUSTION!! METHUSELAH HAS SUCCESSFULLY REACHED THE BOTTOM OF THE STAGE… AND NOW LOOK! HE GETS ON HIS BACK, APPEARING TO BE KNOCKED UNCONCIOUS FROM THE FALL… HBB STILL COMPLETELY UNAWARE!!

HYC: And only NOW is HBB making it back to his feet… he looks over the railing to see the “fallen” Methuselah… he now makes his way down the ring, smirking and grinning, taunting the crowd! Little does he know that Methuselah is just playing possum! HBB reaches the bottom and hops the barricade… he walks up the ramp and reaches the top of the stage, gloating himself… he makes it to the end of the stage and looks over at Methuselah!! AND OH NO… WHAT’S HBB DOING?! HE’S POINTING AT HIS ELBOW… UH OH!

Stew: HE LEAPS OFF THE STAGE… LOOKING FOR THE HEART BREAK ELBOW!! AND METHUSELAH ROLLS OUT OF THE WAY… HBB HITS HIS ELBOW RIGHT ON THE PADDING FLOOR!! BUT FOLKS, DON’T BE FOOLED BY THE WORD ‘PADDING’ BECAUSE IT ISN’T TOO FORGIVING!! HBB COULD HAVE A BROKEN ARM… IN FACT NO, I’M CERTAIN HE DOES!! HE’S SCREAMING AND WRITHING IN PAIN… THE ULTIMATE POSSUM PLAYED BY METHUSELAH!!

HYC: Methuselah gets to his feet and picks up The Heart Break Boy… still writhing in pain, his arm lay limp at his side… METH WHIPS HIM INTO THE SIDE OF THE ENTRANCE RAMP!! HBB HITS SPINE FIRST!! HBB BREAKS AWAY FROM THE RAMP… HOLDING HIS BACK WITH HIS GOOD ARM AND IS MET WITH A KICK TO THE GUT… METH PULLS HIM IN LOOKING FOR THE METH DDT… BUT REVERSAL!! REVERSAL BY HBB AND… SWEET CHIN MUSIC!! METH GETS SUPERKICKED RIGHT ONTO THE RAMP!! HBB begins to move the injured arm around, perhaps trying to get the blood back into it… it’s for sure hurt… how badly I don’t know but the fact that HBB can move it is a very good sign.

Stew: HBB hops up the ramp and pulls himself up onto it. Methuselah using the barricade to pull himself up… AND HE GETS MET WITH A HUGE CHOP BY HBB!!… AND NOW ANOTHER ONE!! THE SOUND OF THE CHOP, ECHOING THROUGHOUT THE ARENA!! HBB lets Meth drop down to his knees as he walks towards the ring, he as well drops to his knees and begins to sift through the objects under the ring… almost as if he’s looking for something special! He drops the ring apron, walks to the other side of the ring and pulls that side of the apron up!

HYC: AND LOOK STEW!! OH MY!! HBB PULLS OUT THAT PAINTBALL GUN, THE SAME PAINTBALL GUN HE USED HE USED AT INSIDE THE EXTREME ELIMINATION CHAMBER AT ROAD TO REDEMPTION!! HE BRINGS THE GUN UP TO METHUSELAH… AND BASHES THE STOCK RIGHT BETWEEN HIS EYES!! AND NOW HE COCKS THE GUN… HOLDS IT UP TO METHUSELAH AT POINT BLANK RANGE… AND BAM!! A LOW BLOW MY METHUSELAH!! A DEFIANT METHUSELAH WITH A LOW BLOW AS HBB DROPS TO THE FLOOR, RELEASING THE PAINTBALL GUN!!

Stew: AND NOW METHUSELAH PICKS UP THE PAINTBALL GUN… HE STANDS OVER HBB… AND SHOOTS HIM RIGHT IN THE CHEST!! AND HE LOADS IT UP AGAIN… BUT LOOK AT HBB!! HBB TRYING TO WRESTLE THE GUN AWAY FROM METHUSELAH!! BUT GOOD LORD!! METHUSELAH SMACKS THE GUN OVER THE HEAD OF HBB… BREAKING IT INTO PIECES!! HBB COLLAPSES BUT METHUSELAH PICKS HIM BACK UP AND ROLLS HIM INTO THE RING… THE HOOK OF THE LEG!! IS E.G.O. OVER!??!

ONEEE!!… TWOOO… AND NO!! HBB KICKS OUT!!

HYC: HBB KICKS OUT AND IMMEDIATELY ROLLS OVER TO HIS STOMACH… A SHARP PIECE OF THAT GUN MUST’’VE PIERCED HBB BECAUSE A STREAM OF BLOOD HAS BEGUN RACING OUT OF HIS HEAD!! Methuselah rolls out of the ring and pulls up the ring apron, we’ve seen a kendo stick and a paintball gun so far… AND NOW A BASEBALL BAT COMES INTO PLAY!! THE SIGNATURE WEAPON OF PROJECT E.G.O.!! AND HOW IRONIC WOULD IT BE, IF THE BASEBALL BAT AIDED IN THE DEMISE OF E.G.O.!! METHUSELAH BRINGS IT INTO THE RING AND POUNDS IT INTO THE CANVAS AS HE AWAITS HBB!!

Stew: HBB gets his hands on the ropes… struggling to even make it back to his feet… his arms are wobbly, the ropes are shaking… the blood is now POURING out of his head… but he remains fighting! For how long though as a baseball bat held in the hands of Methuselah awaits him… HE TURNS AROUND… METHUSELAH SWINGS THE BAT… AND HBB DUCKS IT!! HBB DUCKS UNDER THE SWING OF THE BAT!! HE NOW DARTS OFF THE ROPES AND CONNECTS WITH THE SHOULDER BLOCK!! A SHOULDER BLOCK INTO METHUSELAH!!… AND NOW HE KIPS UP!! HBB KIPS UP AND GRABS THE BASEBALL BAT!!

HYC: And as you documented, each member of E.G.O. is a wizard with a baseball bat… HBB grips it in his hand… Methuselah on his knees… AND HBB CRACKS IT OVER THE BACK OF METHUSELAH!! METHUSELAH FALLS TO THE FLOOR… AND NOW HBB DRIVES THE BAT DOWN INTO THE BACK OF METH’S HEAD!! AND NOW HBB BACKS INTO THE CORNER… A TWISTED LOOK ON HIS FACE, HE MIMICS METHUSELAH BY SLAMMING THE BAT INTO THE CANVAS… METHUSELAH STARTING TO STIR… HBB CONTINUES SLAMMING IT INTO THE CANVAS… METHUSELAH TO HIS KNEES… HE PULLS HIMSELF TO HIS FEET AND TURNS AROUND!!

Stew: AND OH MY GOD!! OH MY GOD!! A HOMERUN SHOT WITH THE BAT RIGHT TO THE SIDE OF METH’S HEAD!! HS COLLAPSES, MOTIONLESS TO THE CANVAS!! THE MOMENTUM CAUSED THE BAT TO FLY OUT OF THE HANDS OF HBB… LANDING AT RINGSIDE, ALMOST HITTING OUR TABLE!! HBB DROPS DOWN INTO THE COVER… HOOKING BOTH LEGS!!

ONEEE!!… TWOOO!!… THRR—SHOULDER UP!! SHOULDER UP BY METHUSELAH!!

HYC: HBB sits up, slams his hand into the canvas… he was sure of victory there! He crawls over to the edge of the ring and rolls out… He plops to the floor and spots the bat! He crawls over to it, grips it in his hand and uses our announce table to make it to his feet… BUT LOOK!! METH TO HIS FEET… HE DIVES OVER THE ROPES, ATTEMPTING A SECOND SUICIDE DIVE!! BUT THIS TIME HBB HAD HIM SCOUTED AND HE THROWS THE BAT AT METHUSELAH, KNOCKING HIM OUT OF THE AIR!! METHUSELAH SPRAWLED OUT ON THE FLOOR AT RINGSIDE HERE!!

Stew: And now look at HBB… he begins to take apart our announce table! Taking off the cover and tossing it aside… He grabs one of the monitors and tosses that aside as well! HE TAKES THE SECOND MONITOR AND SMASHES IT INTO THE HEAD OF METHUSELAH AS HE FOLDS RIGHT BACK TO THE FLOOR!! He wipes everything off the table and grabs Methuselah, pulling him up to his feet… He rolls him into the announce table before climbing up himself!! WHAT IN THE WORLD does HBB have in mind here! He gets Meth to his feet and knees him right in the mid-section!!

HYC: HBB WITH METH IN A PILEDRIVER CLUTCH… DON’T TELL ME!! HBB’S GOING TO PILEDRIVE METHUSELAH RIGHT THROUGH OUR ANNOUNCE TABLE!! BUT HBB CAN’T GET METH UP!! METH REFUSING TO LET HBB LIFT HIM UP… AAND METHUSELAH REVERSES IT INTO A BACK BODY DROP!! BACK BODY DROP ONTO THE TABLE, BUT IT DOESN’T BREAK!! THE TABLE DOESN’T GIVE WAY!! INSTEAD HBB’S SPINE CRACKS OFF THE STURDY TABLE… AS METH DROPS TO HIS KNEES IN EXHAUSTION!!

Stew: Meth however quickly to his feet… HBB still down, he gets HBB to his feet and he pulls him in… AND GOOD LORD!! GOOD LORD ALMIGHTY A METH DDT!! AND THEY GO RIGHT THROUGH THE TABLE!! METHUSELAH WITH A METH DDT AND BOTH MEN CRASH THROUGH THE TABLE!! HBB DOWN, METH DOWN… SOMETHING’S GOTTA GIVE HERE!! Meth begins to stir, he throws a huge piece of table off him and uses my chair to aid him to his feet… he grabs HBB by his legs and pulls him out of the wreckage. A huge gash has formed on the already tender back of Methuselah and now blood begins to drip down… combine that with the blood on HBB’s face and it makes for a gruesome sight, you can tell these men have gone through a WAR and it still isn’t over!

HYC: Meth rolls HBB into the ring… AND HE HOOKS THE LEG!!

ONEEE!!… TWOOO!!… ANDDDD NO SHOULDER UP!!

Stew: Meth runs his hair through his head as he gets to a seated position… he glances over at the turnbuckle, he gets to his feet and begins to climb it, with HBB still down, down and out, yet to move since being driven through the announce table! Meth slowly climbing, in so much pain I’m baffled he can even climb! He gets to the top and sets himself… HE JUMPS OFF WITH A… SHOOTING STAR PRESS!! IT’S ON IT’S WAY!! AND… HBB MOVES OUT OF THE WAY!! HBB ROLLS OUT OF THE WAY AND METHUSELAH CRASHES AND BURNS ON THE CANVAS!!

HYC: AND NOW HBB TO HIS FEET… HE HEADS TO THE APRON AND CLIMBS UP THE SAME TURNBUCKLE… HE LEAPS OFF… HEART BREAK ELBOW!! THE HEART BREAK ELBOW DRIVEN INTO THE ALREADY EXPOSED BACK OF METHUSELAH!! THAT BLOODY AND SCARRED BACK BEING PUNISHED EVEN MORE!! AND HBB POPS UP TO HIS FEET… A RUSH OF ADRENALINE RUNNING THROUGH HIS BODY!! HE GETS TO THE CORNER AND BEGINS TUNING UP THE BAND… AND WILL THIS BE METH’S SWAN SONG!! WILL THIS BE THE SWEET CHIN MUSIC THAT PUTS HIM OUT FOR GOOD?! WILL THIS SWEET CHIN MUSIC SIGNAL THE END OF METH’S CAREER?!?!
Stew: METH TO HIS FEET… HE TURNS AROUND AS HBB CHARGES… BUT METH SIDE-STEPS SWEET CHIN MUSIC!! HE NOW RUNS OFF THE ROPES… SPEAR!! NO!! HBB SIDE-STEPS THE SPEAR AND SENDS METHUSELAH FLYING INTO THE CORNER!! METHUSELAH STOPS HIMSELF… HE NOW TURNS AROUND BUT HBB WRESTLES HIM DOWN TO THE MAT… HE GRABS THE LEGS AND HE LOCKS IN THE INVERTED FIGURE FOUR LEG LOCK!! THE INVERTED FIGURE FOUR IS LOCKED IN ON METHUSELAH!! AND NOW WHAT HAPPENS!! METHUSELAH FINDS HIMSELF A GOOD DISTANCE AWAY FROM THE ROPES, BUT THEY’RE DEFINITELY ATTAINABLE IF HE CAN PULL THE WEIGHT OF HIMSELF AND THE HEART BREAK BOY TO THE ROPES!!

HYC: HBB INCREASES THE PRESSURE, REARING BACK, TRYING TO GET METHUSELAH TO TAP OUT!! METHUSELAH DIGS HIS FISTS INTO THE MAT, IN SERIOUS PAIN HERE!! BUT HE CAN’T GIVE UP!! HE KNOWS IF HE TAPS OUT, IF HE SUBMITS TO THE HEART BREAK BOY, HIS CAREER IS OVER!! HE BEGINS TO CRAWL, BUT HBB ADDS EXTRA PRESSURE… TRYING TO STOP METH FROM PURSUING THE ROPES, BUT WITH HIS CAREER ON THE LINE METHUSELAH IS DAMN NEAR PUTTING EVERYTHING INTO THIS… JUST A FINGERTIP AWAY NOW… BUT HBB PULLS HIM BACK MORE TOWARDS THE CENTER… AND NOW METHUSELAH IS IN GRAVE DANGER OF LOSING HIS CAREER!!

Stew: BUT METH AGAIN PULLING, SCRATCHING AND CLAWING HIS WAY… HE REACHES OUT HIS HAND AND YES!! HE GETS TO THE ROPES!! METH CLUTCHES ONTO THE ROPES AND THE REFEREE FORCES HBB TO BREAK THE HOLD!! But has the damage been done, Chico? Methuselah might’ve used ALL his energy just to get to the ropes there… and who’s to say he can walk… or even stand up on his own, that Inverte Figure Four puts an insane amount of pressure on the legs! Meth grabs onto the ropes… he tries pulling himself up but he falls back to the canvas… HE CAN’T STAND UP!!

HYC: Methuselah, his whole back now a bloody slab of raw flesh… he uses the ropes again… and again falls… He now wraps his entire arm around the ropes and pulls himself up… He turns around… AND SWEET CHIN MUSIC!! SWEET CHIN MUSIC BY THE HEART BREAK BOY!! IT CONNECTS!! RIGHT TO THE JAW… BUT METH FALLS OUT OF THE RING!! METH TUMBLES THROUGH THE MIDDLE ROPE, FALLING TO THE OUTSIDE, FOR CERTAIN CATCHING A BREAK THERE!! AND HBB IS LIVID THAT METH FELL OUT OF THE RING!!

Stew: HBB heads out of the ring… he picks up the dead weight of Methuselah before rolling him back into the ring… Meth crawls over to the other side of the ring… AND UH OH!! LOOK AT HBB!! HE’S LOADING UP AGAIN FOR SWEET CHIN MUSIC!! METHUSELAH COMPLETELY UNAWARE AS HE MAKES IT TO HIS FEET… METH TURNS AROUND SWEET CHIN MUS—NO!! METH CATCHES THE FOOT OF HBB AND TAKES HIM DOWN… AND HE LOCKS IN THE SHARPSHOOTER!! SHARPSHOOTER APPLIED TO THE HEART BREAK BOY!! WILL HE TAP, WILL HBB TAP AND GIVE UP PROJECT E.G.O.?!

HYC: HBB TRIES CRAWLING TO THE ROPES, BUT I’M NOT SURE HE CAN MAKE IT!! NOT IN THE CONDITION HE’S IN!! HE’S LOST SO MUCH BLOOD, HE’S IN SO MUCH PAIN… IT’S NOT WORTH IT HBB!! JUST GIVE UP!! JUST TAP OUT!!

Stew: IT ISN’T JUST ABOUT PROJECT E.G.O. THOUGH CHICO! IT’S ABOUT BEING BETTER THAN METHUSELAH!! HBB BEAT METHUSELAH AT RECKLESS WIRING 3 TO EARN THE RIGHT TO BE CALLED ‘THE GREATEST OF ALL TIME’, BUT THE TITLE HASN’T STUCK!! PEOPLE STILL REGARD METHUSELAH AS THE GREATEST… AND HBB CAN’T STAND THAT!! THAT’S WHY HE WON’T GIVE UP… THAT’S WHY HE CAN’T GIVE UP!! BUT HE MIGHT HAVE TO, I AGREE WITH YOU CHICO… HBB’S IN TERRIBLE SHAPE, HE MAY BE PHYSICIALLY UNABLE TO GET OUT OF THIS!!

HYC: HBB LIFTS HIS ARM UP… HE’S STILL TOO FAR AWAY… HE TRIES TO EARN HIMSELF OVER ON HIS STOMACH… TRYING TO DO EVERYTHING HE CAN… HE MAKES A DESPERATE LUNGE TOWARDS THE ROPES AND HE MAKES IT!! HE MADE IT TO THE ROPES!! I DON’T BELIEVE IT!! And neither can Methuselah! He releases the hold and falls to his knees… a look of desperation on his face, when was the last time we’ve seen this man look desperate in any kind of situation! OH BUT THE LOOK QUICKLY CHANGES!! THE LOOK OF DESPERATION IS NOW A LOOK OF DETERMINATION AND ANGER AS HE BACKS HIMSELF UP INTO THE ROPES!!

Stew: METH RUNS HIS HAND THROUGH HIS HAIR… WE KNOW WHAT’S ABOUT TO HAPPEN!! WE KNOW METH’S INTENTIONS!! HBB PULLS HIMSELF TO HIS FEET… METH CHARGES AND LANDS THE SPEAR!! SPEAR CONNECTS MY GOD!! DAMN NEAR BREAKING HBB IN HALF!! METH INTO THE COVER, HOOKING THE LEGS!!

ONEEE!!… TWOOO!!… THRRRRRR—WHAT?! NO! NO! HBB KICKS OUT!! HBB KICKS OUT OF THE SPEAR I DON’T BELIEVE IT!!

HYC: METH IS SHOCKED!! THE LOOK ON HIS FACE…. IT TELLS THE ENTIRE STORY, HOW IN THE WORLD DID HBB KICK OUT OF THE SPEAR AFTER EVERYTHING THAT HE’S BEEN THROUGH!! AFTER ALL THE PUNISHMENT, AND ALL THE PAIN HE’S EXPERIENCING… HE MANAGES TO KICK OUT OF THE SPEAR!! THE MOVE THAT’S PUT DOZENS AND DOZENS OUT!! Meth gets to his feet and backs up into the corner again… looking to attempt another Spear! If this one hit’s it’s for sure over! If this one hits you can kiss Project E.G.O. goodbye!

Stew: HBB is still down though, Chico! HBB hasn’t moved since being hit with the Spear! He’s completely motionless… maybe that last kick out used the little bit of energy he had left! Maybe he can’t go on! Methuselah however continues to taunt HBB… TELLING HIM TO GET UP!! AND HBB RAISES AN ARM INTO THE AIR, BEGINNING TO STIR!! HE GETS TO HIS KNEES… BEFORE RISING UP TO HIS FEET… METH CHARGES WITH THE SPEAR… AND IT NO!! NO!! SWEET CHIN MUSIC!! SWEET CHIN MUSIC CONNECTS!! AND NOW HBB COLLAPSES ON TOP OF METHUSELAH FOR THE PIN, THAT’S IT, THE CAREER OF METHUSELAH IS OVER!!

ONEEE!!… TWOOO!!… SHOULDER UP!! METH GETS HIS SHOULDER UP!!

HYC: YOU’VE GOT TO BE KIDDING ME!! HBB IS BESIDE HIMSELF!! METHUSELAH KICKED OUT!! HE GETS TO HIS FEET, ENRAGED!! HE’S THROWING A FIT INSIDE THE MIDDLE OF THE RING, IF THAT DIDN’T PUT OUT METHUSELAH… WHAT WILL?! WHAT WILL GET METHUSELAH TO STAY DOWN FOR THE COUNT OF THREE!!

Stew: HBB PULLS METHUSELAH TO HIS FEET AGAIN… TRASHTALKING HIM!!

HBB: “WHY WON’T YOU STAY DOWN?”… “STAY DOWN YOU SON OF A BITCH, IT ISN’T WORTH IT!!”

HYC: BUT OH!! LOOK AT METH!! HE POPS UP AND DELIVERS THE GRAND SLAM!! THE GRAND SLAM CONNECTS!! THE HOOK OF THE LEG!!

ONEEE!!… TWOOO!!… THREEE!!

( Ding! Ding! Ding! )

( ‘Monster’ hits as Methuselah lay next to HBB motionless )

Ring Announcer: Your winner… METTTTHHHUUSSSSEEEELLLLAHHHH!!

Stew: AND HE’S DONE IT!! METHUSELAH HAS DEFEATED THE HEART BREAK BOY!! PROJECT E.G.O. IS OVER!! MY GOD WHAT DEVELOPMENT!!!

( Methuselah begins to stir, the referee raises his hand in victory before he collapses back down to the canvas )

HYC: They left it ALL inside that ring tonight, my respect has been doubled for each man… when I already thought it was at its highest!

( Methuselah slides out of the ring and begins walking up the ramp )

Stew: Project E.G.O. is over ladies and gentlemen, thanks to Methuselah! The tyrannical group that DOMINATED the landscape of the entire company will never be seen again in Extreme Answers Wrestling!

( Camera shows HBB, still lying in the middle of the ring, yet to move a muscle )

HYC: And what does the future behold for that man, The Heart Break Boy, now that Project E.G.O. is over!

Stew: We’ll find out next Sunday on Dynasty, Chico! We’re out of time folks, but we want to thank you all for being a part of Reckless Wiring! A night that none of us will ever forget!

( Camera fades to black )

( EAW logo buzzes )

Reasonable Doubt (2013)

Grand Rampage (2013)