in ,

King of Elite (2019)

An eye for an eye is never enough. Never. Never. NEVER.

//i.imgur.com/xhiRQyph.jpg

( EAW Intro plays )

( Background music accompanies storybook-style animated depictions of African royalty, starting with Amenhotep III, Pharaoh of Egypt. )

Female Narrator: The ruler of the 18th Dynasty of Egypt, a ruler who brought peace, prosperity and stability to his kingdom. The most honored and revered leader not only in the history of The Motherland, but the history of the world.

( The animation switches to depictions of Shaka Zulu, leader of the Zulu Empire in South Africa. )

Narrator: 19th century monarch over modern-day South Africa. Through militaristic measures, Shaka Zulu brought the fledgling Zulu chiefdom to unprecedented heights, as he brought fear and terror into the hearts of dissidents. A fearless warrior who fought as a soldier before ascending to royalty – his name still carries a heavy weight up to this very day.

( The animation transitions into footage of Haile Selassie, depicting his period of rulership. )

Female narrative: Ethiopian king, Haile Selassie, may be History’s last true cult of personality. With a presence of a deity, and the influence that spanned both Hemispheres, many still believe Haile Selassie to be a pious deity to this very day. His sovereignty lasted longer than many lifetimes, having lead his regime for over FIVE DECADES. A figure that, even in his post mortus, will never erode and will never die.

Narrator: The Motherland has seen many a ruler from the dawn of civilization until this very hour. Emperors have risen and have chosen to rule with peace, by force, with cruelty, and with grace. And tonight…

( We see a four way split of the King of Elite Finals competitors. )

Narrator: Another shall ascend to royalty.

( We see action shots and footage of Prince of Phenomenal, mainly from the past year and 1/2 of his career. )

Narrator: Will the excellence of a once-in-a-generational athlete bring the long-standing heir apparent of Phenomenal to his rightful throne?

( We see Jason McKormick delivering his ruthless, violent attacks and standing up to the hegemonic order of The 1% on Friday Night Dynasty. )

Narrator: Will the militant rebel represent the ambitious pursuits of The Score and strike true fear in the powers that be by claiming power for himself?

( We see footage of Malcolm Jones during some of his greatest moments, capturing championships and sealing the deal in major matches. )

Narrator: Will the rose that grew from the concrete jungle set his legacy in stone, and seize upon his destiny by capturing the crown?

( We get footage of Jack Ripley competing on Voltage with more vigor and more passion than seen before. )

Narrator: Or will the daring, audacious, previously dismissed and overlooked prodigy finally put the entire Land of Elite on notice?

( The dramatic music intensifies as a highlight reel continues to show all four Elitists during their best moments, executing their signature moves, and bulldozing through the competition that stood between them and the King of Elite Finals. The footage comes to an end. )

Narrator: AND NOW…

( The King of Elite animation graphics appear on the screen as “The Mantra” by Mike WiLL Made-It, Pharrell and Kendrick Lamar plays. )

Narrator: ELITE ANSWERS WRESTLING PROUDLY PRESENTS TO YOU, THE 11TH ANNUAL, KING OF ELITE!!!!

( We then transition to the FNB Stadium where the ENTIRE venue is filled with cheering fans, and fireworks rocket off from the stage, as well as the tops of the stadium. The camera pans through the massive audience, as they unleash every ounce of energy they have for this event. )

Stew-O: A RECORD AUDIENCE FOR THIS HISTORIC EVENT HERE THIS AFTERNOON AS WE TALLY 90,807 MEMBERS OF THE EAW UNIVERSE FROM ALL OVER THE WORLD, FROM OVER 56 COUNTRIES! ON A NIGHT WHERE WE WILL CROWN THE NEWEST KING OF EAW, AND DETERMINE WHO FROM ALL FOUR EAW BRANDS WILL LEAD THEIR ROSTERS AS WORLD CHAMPIONS, WELCOME TO THE 11TH EDITION OF EAW: KING OF ELITE!!!!!!!!!!!!!!

…..

(The camera cuts ringside as Stephie Love stands ready.)

Stephie Love: The following contest is scheduled for ONE FALL!!! AND IS FOR THE ANSWERS WORLD CHAMPIONSHIP!!!!

Talib: WOW! What a way to start off the night! THE GOD EMPEROR AGAINST THE ACE OF EAW!! Ladies and gentlemen, strap yourself in because you may very well be about to see the absolute match of the year! Two generational talents against each other for the Answers World Championship!

(“Ultimate Battle” by ZENTA hits as Jamie O’Hara makes his way out to a THUNDEROUS ovation.)

Stew: What a response for the longest reigning World Champion in company history! He looks to end the reign of terror that is Theron’s reign over Dynasty; SYNCON returned at Road to Redemption and immediately set his eyes on the top man on the red brand!

Talib: The biggest challenge of Theron’s career. I cannot predict how this match is going to end; Jamie has proven in the past that there are so few that can hit the level that he is on, but the champion is a man that gets better with every match this he is in. It’s a match is so many possibilities and the unpredictability of what’s to come is so exciting. There is so many few times that you have no idea on what’s about to happen; Jamie O’Hara against Theron Nikolas! The God Emperor against The Ace!

(“I Hope You Suffer by AFI hits as Theron Nikolas makes his way through the curtain with the Answers World Championship hanging from his left shoulder to a CHORUS of boos from everyone in the arena.)

Talib: The question that I find myself asking is that if this man is able to retain his championship tonight – who can possible take it from him! Starr has thrown him arguably the best that he can possibly offer; the greatest challenge of his career.

Stew: If Theron manages to retain, without any controversy, it destroys any doubt the man has to bear. Theron is great; a man that I don’t believe needs the help that he has had in the past few months; the Elimination Chamber proving that, but he has taken such a dark route. What I find myself asking is who can take that champion off him if he wins – but happens if he loses tonight.

(Both the Champion and Challenger stand in their respective corners as Stephie Love begins the formal introductions.)

Stephie Love: Introducing first the CHALLENGER from Melbourne, Australia, weighing in tonight at ONE HUNDRED AND NINETY POUNDS!!!… HE IS THE “ACE OF EAW”!!!! JAMIE O’HAAAAAARAAAAA!!!!!

(Jamie remains stoic; his eyes locked on Theron who stands with an arrogant smirk on his face.)

Stephie Love: Introducing the CHAMPION, from Edmonton, Alberta, Canada, weighing in tonight at TWO HUNDRED AND TEN POUNDS!!!! HE IS THE “GOD EMPEROR!!!!”… THE REIGNING, DEFENDING, ANSWERS WORLD CHAMPION!!!!!! THERON NIIIIIKKKKOOOLLLAAAASSS!!!!!!!

(Theron raises the championship high into the air before handing it over the AWC to the referee. He shows it to O’Hara before raising it in the middle of the ring and handing it to the time keeper and calling for the bell.)

(Ding! Ding! Ding!)

Stew-O: The bell rings and this contest is absolutely BLOCKBUSTER of a King of Elite Answers World Championship match is underway. The hype built around this contest from the moment that Jamie returned to the company at Road to Redemption has been incredible, and by the look in both of their eyes – I have no doubts that we are about to see something so, so special. I don’t believe either man is going to be willing to stay down until there’s absolutely nothing left.

Talib: Neither man has taken a step out of their respective corner; both soaking in the incredible atmosphere provided here tonight. The crowd FIRMLY behind the challenger right now as he takes the first step forward. Jamie slowly making his way to the middle of the ring calling Theron forward. The Answers World Champion slowly steps forward and meets his challenger. Both men standing nose to nose; we can’t hear what they’re saying to each other, but you can’t imagine that it’s not too pretty. The two taking a step back and slowly circle around the ring; they lock up in the middle of the ring! Theron takes the advantage slipping behind Jamie and locking the waist! Jamie’s able to quickly twist out of it and into an arm wrench, but Theron able to use the opening to transition into one of his own! Theron’s trying to gain some leverage, but Jamie drives his boot into the midsection of the champion with a STIFF kick.

Stew-O: Theron takes in a deep breath as he drops down to knee; Jamie doesn’t waste any time taking Theron down to the canvas as the champion pushed himself back up. Jamie locks the knee, but Theron uses his free leg to push Jamie down to the canvas – THERON TRYING TO LATCH ONTO THE ARM AND LOCK IN A CROSS ARMBREAKER! Jamie immediately shifts his weight and pushes Theron up onto his shoulders!

ONE!…

Stew-O: Theron releases the arm and Jamie is free – STANDING DOUBLE FOOTSTOMP FROM THE CHALLENGER! Theron rolls out of the way and scrambles back to his feet AND JAMIE SWINGS WITH A WILD ROUNDHOUSE KICK! Theron duck and rolls straight out of the ring! Theron looking for some early breathing room – BUT JAMIE ISN’T GOING TO GIVE IT TO HIM! JAMIE HITS THE ROPES AND SHOOTS BACK ACROSS THE RING! TOPE CON HILO!!! THERON SLIDES BACK INTO THE RING UNDER THE CHALLENGER – WOW!! JAMIE CATCHES HIMSELF ON THE TOP ROPE AND FLIPS ONTO THE APRON!! Theron turns – AND JAMIE MEETS HIM WITH A KICK TO THE SIDE OF THE HEAD!! The champion is stunned as Jamie O’Hara lines him up on the apron! JAMIE SPRINGBOARDS OFF THE TOP ROPE – SPRINGBOARD KNEELIFT!! Theron dodges! Jamie hits the canvas and rolls through to avoid the impact – BUT THERON CATCHES HIM WITH A SUPERKICK!

Talib: JAMIE CAUGHT THE BOOT! Jamie spins the Answers World Champion around AND LOCKS THE WAIST! OVERHEAD GERMAN SUPLEX! THERON LANDS ON HIS FEET! Theron backs into the corner as Jamie shoots forward! Theron cuts him off with an elbow, and shoots straight into a side headlock! Both men have been looking for control throughout the entire opening minutes of this contest and Theron has decided the best option is to slow things back down! Jamie pushing Theron into the ropes, looking to pick up enough momentum to push the Answers World Champion away, but Theron doesn’t lose his grip, managing to take Jamie down to the canvas! Theron has complete leverage over the challenger!

Stew-O: Theron trying to slip the forearm under the chin of the challenger and potentially cut off the corroded artery and blood flow to the brain! Jamie is fighting! Jamie fighting back to his feet, but Theron refuses to release the challenger! Jamie needs to find a way out of the hold – AND HE JUST MAY HAVE POWERING THERON UP ONTO THE AIR AND DRIVING THE CHAMPION BACK DOWN TO THE CANVAS WITH A BACK SUPLEX! Theron fights through and reapplies that side headlock! Jamie may have just put himself in a worse position! Theron rolls back and turns Jamie back onto his stomach. Theron wants that leverage over the challenge; to control absolutely everything about this match. Jamie pushing himself back up to his feet again – but, the moment that Jamie’s able to get to a knee Theron transitions back behind the challenger and looks to back him down with a back suplex of his own! Jamie flips back and lands on his feet!

Talib: Jamie staggers back into the corner as Theron shoots forward! Jamie cuts him off with a side kick to the stomach! Theron clutches at his midsection and Jamie jumps up onto the middle rope and back over the champion! Sunset Flip! Theron rolls through and flips over Jamie with the Jackknife cover!

ONE!!… TWO!!…

Stew-O: What core strength from Jamie O’Hara! The challenger bridging out of the cover and twists! Jamie takes the Champion down with a backslide!

ONE!!… TWO!!…

Talib: Theron rolls out of it and finally the two stop. Both men on their knees staring back at each other as the thousands in attendance give them a standing round of applause. These two men have done everything they can to try and gain some kind of advantage over the other and they finally reach a stalemate. They’ve have an answer for what both have tried to do. The champion and challenger getting back to their feet and once more find themselves circling around the ring. We are back to where we started. They look to lock up – Theron with a kick to the gut of O’Hara! Jamie catches the boot! Jamie fires a STIFF kick to the hamstring of the challenger. The pain evident on the face of Theron Nikolas – DRAGON SCREW FROM JAMIE O’HARA!! Theron screaming in pain as he clutches at the knee! Theron backing himself into the corner, but Jamie has no intention of letting Theron recover. Theron pushing himself back to his feet – Jamie meets him with a shoot kick to the chest! Jamie follows with a second kick; this time placed straight to the side of the right knee!

Stew-O: Jamie grabs Theron by the arm and sends him across the ring! Jamie looks to follow, but Theron’s about to use to the top rope in the corner to pop back overhead of the challenger! Jamie turns around as THERON FIRES WITH A SUPERKICK! JAMIE COVERS UP, BUT IT’S ONLY A FEINT! THERON DRIVES THE BOOT INTO THE TOP OF THE KNEE OF JAMIE O’HARA! Jamie drops down to his knees AND THERON FOLLOWS WITH A KICK TO THE JAW! The challenger sent rolling under the bottom rope and to the outside as the Answers World Champion like a shark smells blood follows! Jamie pushing himself back to his feet – BUT, THERON GRABS HIM AND SENDS HIM CRASHING SPINE FIRST INTO THE BARRICADE! Theron soaking in everything being thrown his way by the thousands in attendance; their reaction has not fazed him in the slightest!

ONE!… TWO!… THREE!… FOUR!…

Talib: Theron knows that he’s finally in control of this match, Stew! Jamie’s back to his feet and catches Theron in the stomach with a kick, but Theron immediately fires back with a European Uppercut! Look at Theron! He grabs Jamie and swings around – THERON LOOKING FOR A VERTICAL SUPLEX THAT WILL END WITH JAMIE’S SPINE MEETING THE TOP OF THE BARRICADE! JAMIE WITH A KNEE TO THE TOP OF THE HEAD! JAMIE’S ABLE TO FIGHT BACK DOWN TO HIS FEET! JAMIE WITH A FOREARM! A SECOND! THIRD! FOURTH! JAMIE PULLS THERON IN AND LIFTS THE ANSWERS WORLD CHAMPION’S FEET UP ONTO THE BARRICADE!

Stew: OH MY GOD!

Talib: JAMIE O’HARA JUST SPIKED THE ANSWERS WORLD CHAMPION HEAD FIRST INTO THAT THIN, THIN PADDING THAT COVERS THE CONCRETE FLOORING WITH THAT HANGING DDT! THE REFEREE IMMEDIATELY STOPPING HIS COUNT AND RUSHES OUT OF THE RING TO CHECK OF THE CHAMPION! JAMIE SHOVES THE REFEREE OUT OF THE WAY, DRAGS THERON BACK UP TO HIS FEET AND OVER THE BARRICADE! WHAT IS THE CHALLENGER THINKING? HE NEEDS TO GET THERON BACK INTO THE RING IF HE WANTS TO WIN THE ANSWERS WORLD CHAMPIONSHIP! THERON CLUTCHING AT HIS NECK AS HE PUSHES HIMSELF BACK UP TO HIS FEET – LOOK AT JAMIE O’HARA! JAMIE SHOOTS ACROSS THE RINGSIDE AREA AT FULL SPEED AND LEAPS OVER THE BARRICADE DRIVING THE ANSWERS WORLD CHAMPION DOWN TO THAT CONCRETE FLOORING WITH A DOUBLE FOOTSTOMP!

Stew: What a move from the longest reigning World Champion in company history! Jamie grabs the champion and throws him back over the barricade! Jamie hops back over the barricade and stalks as Theron tries to crawl away! Jamie grabs onto the champion and rolls him back into the ring and shoots up onto the apron! Theron trying to shake out the cobwebs as Jamie SLINGSHOTS OVER THE TOP ROPE AND CONNECTS WITH A TOPE! The challenger crashing down across the chest of the champion as he rolls through and smoothly gets back to his feet! Theron rolling into the corner and drags himself back up as Jamie stalks from the opposite corner. Jamie’s eyes have not left the Answers World Champion! Theron’s back of his feet as Jamie BURSTS FORWARD!

Talib: SUPERKICK!!! BANG!!! JAMIE IS STUNNED, DROPPING DOWN TO A KNEE – AND THERON GRABS HIM AND SENDS HIM CRASHING SHOULDER FIRST INTO THE RINGPOST!! Jamie hanging in the corner as Theron grabs the challenger and pulls him back into the ring! Jamie falls down to the canvas and starts dragging himself across the ring towards the ropes, but Theron has no intention of allowing him to get back to his feet! Theron with a knee to the side of the ribs of Jamie O’Hara! Jamie drops down back down to his stomach and Theron follows with a second! Jamie trying defiantly drag himself to the ropes, but Theron slides across and applies the grounded front face lock! Theron drives the point of the knee into the top of the head! Jamie grabbing at the forearm of the champion, trying to break the grip, but Theron drives the knee into the top of the head again!

Stew: Theron slowing this contest right down; he knows with everything that Jamie has shown throughout his illustrious career that he’s going to have to go above and beyond to walk out tonight still the Answers World Champion. Theron needs wear Jamie down. He needs to try to break the seemingly unbreakable spirit of the Ace of EAW! Theron transitions into the back mount! Theron with a grazing palm strike to the back of the head of the challenger! Jamie trying to cover up, but the angle of these strikes are so hard to block! Jamie needs to get out of this predicament, but that’s easier said than it is done. Jamie is going to have to bear the champions weight. There will not be an opportunity for Jamie to wait for. Theron will not give it to him. Theron varying in his shots; a palm strike to the back of the head followed by a hard shot to the side of the ribs! Jamie trying to fight through and reach out to the ropes, but Theron transitions back into the front face lock. No!

Talib: Jamie’s able to twist out of it during that slight opening! Theron latches onto the wrist and pulls him into a forearm! Jamie drops back down to a knee before Theron pulls him back up to his feet and sends him into the ropes with an Irish whip! Jamie turns it around! Theron hits the ropes and Jamie leapfrogs over the Champion! Look at Theron! Theron slid under Jamie and shoots back behind Jamie as he turned! Jamie doesn’t see Theron! Theron hits the ropes behind the challenger as O’Hara turns back – AND THERON ALMOST TAKES HIS HEAD OFF WITH A SICK KICK!! Jamie turned absolutely inside out as Theron shoots back to his feet!

Theron: AN ACE DOES NOT COMPARE TO A GOD EMPEROR.

Stew-O: Theron knows his in complete control, but he cannot allow Jamie any time to recover. They glazed eyed look covering the face of Jamie as the Answers World Champion drags the challenger back to his feet and tosses him through the ropes and out of the ring!

Theron: THIS IS MY RING. THIS IS MY ARENA. THIS IS MY KINGDOM.

Talib: Theron may be taking a little more time than he should be as Jamie pushes himself back up. Theron has the challenger locked in his sights as he hits the ropes AND SHOOTS BACK ACROSS THE RING!! TOPE SUICIDA!! THERON FLIES THROUGH THE ROPES – JAMIE MOVES!!! THERON CRASHES AND BURNS INTO THE BARRICADE!! THERON’S OVERCONFIDENCE CAME BACK TO HAUNT HIM!!

Stew-O: Theron is going to have to learn that he cannot take his foot off the accelerator against Jamie. Its lapses of concentration like that which will cost him that Answers World Championship! Jamie’s back up to his feet; he’s trying to shake out the cobwebs, but he’s in a much better condition than the champion right now. Theron grabs the top of the barricade and drags himself back up to his feet, and Jamie rolls him back into the ring! Jamie shoots up onto the apron and up to the top rope! Theron push himself back up to a knee, trying to find his challenger, but Jamie is perched behind him! JAMIE LEAPS AS THERON PUSHES HIMSELF BACK TO HIS FEET – HEADHUNTER?! JAMIE WITH THAT DIVING MISSILE DROPKICK TO THE BACK OF THE HEAD OF THE ANSWERS WORLD CHAMPION!!!

Talib: Jamie playing some “head” games with the Answers World Champion reaching into the playbook of one of Theron’s biggest rivals! Theron sent rolling into the corner and he tries to drag himself back to his feet as quickly as possible! JOHN WOO DROPKICK!! JAMIE O’HARA WITH A RUNNING DROPKICK TO THE CHEST OF THERON NIKOLAS!! THERON SHOT BACK SPINE FIRST INTO THOSE TURNBUCKLES!! THERON DROPS DOWN INTO THE CORNER AND O’HARA DOESN’T LOOK LIKE HE’S FINISHED!! HESITATION DROPKICK!!! BOTH FEET DRIVEN INTO THE CHEST OF THE ANSWERS WORLD CHAMPION!!! Theron rolls out of the corner as Jamie calls him back to his feet! That one mistake earlier may have cost Theron his championship! Theron getting back up as he takes in those deep breaths, trying to catch him breath after having the air driven out of his lungs!

Stew-O: Theron’s back up – and Jamie meets him with a kick to the stomach! JAMIE PULLS HIM IN!! JAMIE TRYING TO HOOK THE LEG, BUT THERON’S ABLE TO TWIST OUT OF IT!!! THERON KEEPS A HOLD OF THAT WRIST!!! TOUCH OF HEROINE!!!!!! JAMIE DUCKS UNDERNEATH!!! SPINNING BACKFIST FROM THE ACE OF EAW!!!! SPINNING BACK KICK TO THE MID SECTION!!! JAMIE WITH A KICK TO THE FACE OF THE CHAMPION!!! JAMIE WITH A FOREARM!!! A SECOND!!! JAMIE PUTS EVERYTHING INTO THE THIRD!!! THERON FALLS BACK, BUT HE FALLS INTO THE ROPES AND THEY KEEP HIM STANDING!!! JAMIE WITH A LARIAT!!! THERON DUCKS AND LOCKS THE WAIST OF O’HARA!!!! SNAP CANADIAN SUPLEX!!!! JAMIE DROPPED ON THE BACK OF HIS HEAD!!! JAMIE IS ALREADY BACK TO HIS FEET!!! DISCUS LARIAT FROM THE LONGEST REIGNING WORLD CHAMPION IN EAW HISTORY!!!!

Talib: Theron rolling onto his stomach and pushes himself up onto his hands and knees! BUT, THAT’S AS FAR AS JAMIE LETS HIM GET!!! JAMIE LOCKS THE ANSWERS WORLD CHAMPION BY THE WAIST AND POWERS HIM UP!!! WOW!!! HIGH ANGLE DEADLIFT GERMAN SUPLEX!!! THERON NIKOLAS DROPPED ON THE BACK OF HIS HEAD AND JAMIE HOLDS THE BRIDGE!!!!

ONE!!!!… TWO!!!!… KICKOUT!!!!

Stew: The Answers World Champion powers out, but he’s certainly not in a good way!

Talib: But, the challenger is Stew! Jamie gets back to his feet as this entire arena wills him on! Jamie backing into the corner and calls the champion back to his feet! Jamie has one thing on his mind; one more shot to put the champion into absolute unconsciousness! THERON SLOWLY PUSHING HIS WAY BACK TO A KNEE!! JAMIE BURSTS OUT OF THE CORNER!!!! IN EXCELSIS – SUPERKICK!!!! NO!!!! JAMIE CATCHES THE BOOT!!!! JAMIE SHAKES HIS HEAD, TELLING THERON THAT THERE’S NOTHING HE CAN DO!!! JAMIE SWINGS THERON AROUND – SWINGING ENZIGURI!!! THERON TRIES AND FAILS AGAIN AS JAMIE AVOIDS CONTACT!!! THERON HITS THE CANVAS AND STUMBLES BACK TO HIS FEET!!!

Stew: JAMIE HOOKS HIM!!! GALACTIC BUSTER!!!! PUMPHANDLE LUNGBLOWER!!! KNEES DRIVEN INTO THE SPINE OF THE CHAMPION!!!! JAMIE DOESN’T GO FOR THE COVER!!!! HE INSTEAD CHOOSES TO ROLL UNDER THE BOTTOM ROPE AND BEGINS TO CLIMB TO THE TOP ROPE!!! THE THOUSANDS IN ATTENDANCE ARE ON THEIR FEET!!!! THE CHAMPION HAS NOT MOVED!!!! GENKI CANNON!!!! DIVING DOUBLE FOOTSTOMP!!!! THERON MOVES OUT OF THE WAY!!!! JAMIE HITS THE CANVAS AND ROLLS THROUGH, POPPING BACK UP TO HIS FEET!!!

Talib: SPEAR!!!!!!!! THERON JUST ALMOST CUT JAMIE O’HARA IN HALF WITH THAT DEDEDE ENDORSED SPEAR!!!! THERON HOOKS BOTH LEGS!!!!

ONE!!!!!!!… TWO!!!!!!!… KICKOUT!!!!!

Talib: JAMIE KICKS OUT!!!

Stew: Wow! Theron just rolls off of Jamie! I don’t know if Theron realised how close he just came to retaining his championship; it must have only been instincts after the barrage of offense from the challenger! Both men are down on the canvas; Theron is in no condition to capitalise. Jamie clutching at his ribs, but he’s a step ahead of Theron. Jamie’s back to his feet and Theron’s back to a knee. Jamie waits until the Answers World Champion gets back to a vertical base BEFORE JAMIE CRACKS HIM IN THE CHEST WITH AN UNFORGIVING CHOP TO THE CHEST!! THE SOUND ECHOING AROUND THE ARENA!!!

Talib: Theron fires back with a forearm! Jamie with a second chop! Theron doesn’t back down! Forearm to the jaw! A third chop! Forearm! Jamie fires back with one of his own! Theron! Jamie! Theron! Jamie! Theron! Jamie! Jamie! JAMIE WITH A STIFF BOXING SHOT TO THE RIBS! TIGER KNEE TO THE JAW! Theron drops down to a knee as Jamie hits the ropes! BUT, CHARGES STRAIGHT BACK INTO A STANDING BICYCLE KICK!! Jamie refuses to fall – FIRING BACK WITH A SIDE KICK TO THE GUT OF THE ANSWERS WORLD CHAMPION!! THERON CATCHES THE BOOT AND SWINGS JAMIE’S BOOT BACK – SUPERKICK!!!! BANG!!! PELE KICK FROM O’HARA!!!! THERON FALLS BACK INTO THE ROPES AS JAMIE TRIES TO SCRAMBLE BACK TO HIS FEET – SHINING WIZARD!!!! BRUTAL KNEE TO THE HEAD OF THE CHALLENGER!!!! THERON STANDS OVER JAMIE!!! THERON REACHING DOWN AND DRAGS JAMIE BACK TO HIS FEET; THERON IS READY TO FINISH THIS!!!

Stew: JAMIE MAY BE ON DREAM STREET!! THERON LOCKS ONTO THE WRIST AND SETS HIM INTO POSITION!!! A TOUCH OF HEROINE!!!!!

Talib: BICYCLE KNEE!!!! JAMIE COUNTERED!!! THERON’S LEGS FALL OUT FROM UNDER HIM AS HE DROPS DOWN TO HIS KNEES!!!! JAMIE GRABS BOTH ARMS OF THERON AND PULLS HIM INTO ANOTHER VICIOUS KNEE TO THE HEAD!!!! JAMIE IS NOT FINISHED!!!! IN EXCELSIS!!!!!! RUNNING BICYCLE KNEE STRIKE TO THE HEAD OF THE ANSWERS WORLD CHAMPION!!!!!! JAMIE FALLS INTO THE COVER!!!!

ONE!!!!!!!!!… TWO!!!!!!!!!… THRE-KICKOUT!!!!!!

Stew: Theron kicks out, but this is where Jamie’s experience in matches like this is coming into play! Jamie stalks! Jamie not wasting a second! Theron crawling towards the ropes, latching onto the middle rope trying to pull himself back up to a knee – A SECOND RUNNING BICYCLE KNEE STRIKE!! THERON JUST SLOUCHED ON THE MIDDLE ROPE AS JAMIE DOESN’T SLOW DOWN, HITTING THE ROPES AND CHARGES BACK – BUT, THERON SHOOTS BACK TOWARDS HIM AND DRIVES HIS SHOULDER INTO THE RIGHT KNEE!! JAMIE LEG CUT OUT FROM UNDER HIM; THERON HIT HIM JUST ABOVE THE KNEECAP!!! JAMIE ROLLING AROUND IN ABSOLUTE AGONY AS THERON STAGGERS BACK TO HIS FEET!!

Talib: Theron’s like a shark that smells blood, Stew! Theron dragging the challenger back into the middle of the ring and begins to attack that leg! Theron with an elbow to that knee! Jamie trying to drag himself away, but Theron isn’t going to let him go anywhere! Theron grabs that leg, lifting it high into the air and slams it down into the canvas! He does it again! This is brilliant! You take away that leg and you take away the majority of O’Hara’s offense! Look at the Answers World Champion! THERON LOCKS IN THAT FIGURE 4 LEGLOCK!! JAMIE TRAPPED IN THE MIDDLE OF THE RING!! EACH PASSING SECOND HAS TO BE ABSOLUTELY EXCRUCIATING!!! THE LOOK ON THE FACE OF JAMIE TELLS THE ENTIRE STORY!!! JAMIE REACHING TOWARDS THE ROPES, BUT THEY MUST FEEL LIKE THEY’RE MILES AWAY!!

Stew: HOW LONG WILL JAMIE BE ABLE TO SURVIVE IN THIS SUBMISSION – HELL, EVEN IF HE MANAGES TO ESCAPE – THINK ABOUT THE DAMAGE THAT HAS BEEN DONE!!! THERON APPLYING AS MUCH PRESSURE AS HE CAN!!! JAMIE… ROLLS ONTO HIS STOMACH, BUT THERON USES THE MOMENTUM TO ROLL JAMIE STRAIGHT BACK ONTO HIS BACK!!! JAMIE TRYING TO REACH OUT TO THE ROPES; HE’S MANAGES TO MAKE UP A LOT OF DISTANCE, BUT JAMIE… TAPS!!!! NO, HE JUST STOPS HIMSELF!!! JAMIE REFUSING TO QUIT!!!

Talib: HIS BODY MAY GIVE UP ON HIM!!! JAMIE’S SHOULDERS DROP DOWN TO THE CANVAS!!!

ONE!!!!… TWO!!!!…

Talib: JAMIE FORCING HIS SHOULDERS BACK OFF THE CANVAS AND REACHES!!!!

Stew: HE REACHES THE ROPES!!! THERON IS FORCED TO RELEASE THE HOLD!!! THE REFEREE RIPPING THERON AWAY FROM THE CHALLENGER AS JAMIE CLUTCHES AT THAT LEG!!! I DON’T KNOW IF THE CHALLENGER IS GOING TO BE ABLE TO STAND!!! THERON CALLING THE LONGEST REIGNING WORLD CHAMPION IN EAW HISTORY BACK TO HIS FEET!!! THERON MAY HAVE JUST SECURED A SUCCESSFUL RETENTION!!!! ARGUABLY THE BIGGEST WIN OF HIS CAREER!!! JAMIE DRAGGING HIMSELF BACK TO HIS FEET WITH THE HELP OF THE ROPES, BUT THERON HAS HIM ABSOLUTELY LOCKED IN HIS SIGHTS!!!! JAMIE IS UP – SUPERKICK!!!!! JAMIE CAUGHT FLUSH ON THE JAW!!!! JAMIE FALLS BACK INTO THE ROPES AND STUMBLES BACK FORWARD!!! THERON SCOOPS HIM OFF HIS FEET AND INTO THAT FIREMAN’S CARRY POSITION!!!! USHIGOROSHI!!! JAMIE DROPPED NECK FIRST ACROSS THE KNEE OF THE ANSWERS WORLD CHAMPION!!!! JAMIE DOWN IN A SEATED POSITION AS THERON LOCKS HIM BY THE WRIST!!!! THERON LOOKED FOR THAT TOUCH OF HEROINE AGAIN!!!! THERON PUSHES HIM AWAY – BICYCLE KNEE FROM O’HARA!!!!

Talib: THERON SEEN IT COMING THIS TIME!!!! THERON AVOIDS DEVASTATING CONTACT!!!! THERON STILL HAS GRIP ON THE WRIST OF O’HARA!!!! A TOUCH OF HEROINE!!!!!!! JAMIE O’HARA FOLDED IN HALF BY THE ANSWERS WORLD CHAMPION!!!! THERON FALLS INTO THE COVER!!!!!!

ONE!!!!!!!!!… TWO!!!!!!!!!!… KICKOUT!!!!!!

Talib: JAMIE POWERS OUT!!!!

Stew: ABSOLUTE DESPERATION!!! THAT’S WHAT COVERS THE FACE OF THE ANSWERS WORLD CHAMPION!!!! HE PUT EVERYTHING HE COULD PHYSICALLY MUSTER INTO THAT SHOT AND IT WAS JUST NOT ENOUGH!!! Theron pushing himself back to his feet; he needs to remain composed. Theron dragging the challenger back to his feet and calls for the end! Theron pulls the challenger in and tries to power him high into the air! Jamie’s fighting! Jamie still with enough wherewithal to know the position he’s in! Jamie’s able to fight back down to his feet, but the champion clubs him in the back! Theron with relentless shots to the spine of the challenger! JAMIE FIGHTS THROUGH IT AND DRIVES THE CHAMPION BACK INTO THE CORNER!

Talib: Theron hit those turnbuckles hard! Jamie backs up AND SHOOTS FORWARD FOR A FLYING FOREARM, BUT THERON’S ABLE TO SIDESTEP!!! Jamie hits the corner chest first – THERON WITH A RUNNING DROPKICK TO THE SIDE OF THE HEAD!! Theron grabbing the top rope, slingshotting onto the apron as his boot caught Jamie! Theron looking to slingshot back over the top rope – BUT JAMIE CATCHES HIM WITH THAT ROPE AIDED ROUNDHOUSE!! THERON CRASHES DOWN TO THE OUTSIDE AS JAMIE BEGINS TO PICK UP SOME MOMENTUM!! TOPE CON HILO!!!!! JAMIE O’HARA SOARING OVER THE TOP ROPE AND TAKES OUT THE ANSWERS WORLD CHAMPION!!!!

Stew: JAMIE CLUTCHING AT THAT KNEE, BUT HE’S JUST GOING TO WITHSTAND THE PAIN!!!! JAMIE ROLLS THERON BACK INTO THE RING AND BEGINS TO MAKE HIS WAY TO THE HIGH RENT DISTRICT!!! THERON PUSHING HIMSELF BACK TO HIS FEET AS JAMIE LEAPS!!!!! GENKI CANNON!!!!! DIVING DOUBLE FOOTSTOMP TO THE BACK OF THE HEAD OF THE BENT OVER THERON!!!! THERON HITS THE CANVAS AS JAMIE CLUTCHES STRAIGHT BACK TO THAT KNEE!!!! JAMIE FORCING HIMSELF BACK UP, TRYING TO GET BLOOD FLOW BACK THROUGH THAT LEG!!!! THERON IS DRAGGING HIMSELF BACK UP IN THE CORNER!!! JAMIE CHARGES ACROSS THE RING – SUPERKICK!!!!!! JAMIE DOESN’T GO DOWN, BUT THE IMPACT STAGGERS HIM!!!! SUPERKICK!!!!! THIS TIME TO THE BACK OF THE HEAD!!!!!! JAMIE DROPS DOWN TO HIS KNEES – WHAT?! IN EXCELSIS!!!!!! THERON JUST CRACKED JAMIE O’HARA IN THE BACK OF THE HEAD WITH HIS OWN MOVE!!!!

Talib: JAMIE IS OUT!!!! THERON ROLLS HIM ONTO HIS BACK!!!!! HE MAKES THE COVER!!!!!

ONE!!!!!!!!!!!… TWO!!!!!!!!!!!… THRE-KICKOUT!!!!!!!!!!!

Talib: JAMIE GETS THE SHOULDER UP!!!! AND THERON HAS LOST IT!!!!! THERON SHOOTS BACK TO HIS FEET AND INTO THE FACE OF THE REFEREE!!!! THERON TURNS BACK TOWARDS JAMIE AND LOCKS BOTH HIS ARMS!!!! THERON DRIVES HIS BOOT INTO THE FACE OF O’HARA!!!! AGAIN!!!! AGAIN!!!!! AGAIN!!!!! UNRELENTING, UNPROTECTED, UNFORGIVING SHOTS TO THE HEAD OF JAMIE O’HARA!!!!! IF JAMIE WASN’T FINISHED BEFORE THIS – HE CERTAINLY WILL BE WHEN THERON IS FINISHED!!!! THERON FINALLY RELEASES THE ARMS OF JAMIE AND DROPS INTO THE COVER!!!! THERON HAS RETAINED THE ANSWERS WORLD CHAMPIONSHIP!!!!!

ONE!!!!!!!… TWO!!!!!!!… KICKOUT!!!!!!

Stew: I CANNOT BELIEVE IT!!!! JAMIE KICKS OUT WITH AUTHORITY!!!!! THERON CANNOT BELIEVE IT!!!! I CAN’T BELIEVE IT!!!! THERON IS IN ABSOLUTE SHOCK!!!!! THERON JUST PUSHING HIMSELF BACK INTO THE CORNER; HE ISN’T TAKEN HIS EYES OFF O’HARA!!!! LOOK AT THE EYES OF JAMIE!!!! JAMIE ALREADY PUSHING HIMSELF BACK TO HIS FEET – FURY AND FIRE IN HIS EYES!!!! THOSE SHOTS DIDN’T KNOCK HIM OUT – I THINK THEY WOKE HIM BACK UP!!! THEY IGNITED SOMETHING DEEP DOWN INSIDE THE CHALLENGER!!!! SUPERKICK!!!!! THERON CRACKS JAMIE IN THE JAW WITH ANOTHER SUPERKICK!!!!

Jamie: IS THAT THE BEST YOU GOT, CUNT?

Stew: THE SUPERKICK DID NOTHING!!!! THERON GRITTING HIS TEETH; HE DOESN’T KNOW WHAT TO DO!!! THERON WITH A FOREARM!!! JAMIE CRACKS THERON BACK WITH ONE OF HIS OWN!!!! THERON DOESN’T BACK DOWN!!!! JAMIE CRACKS HIM WITH ANOTHER!!!! THERON!!!! JAMIE!!!! THERON!!!! JAMIE!!!! BOTH WITH WILD SHOTS TO THE OTHER; BOTH MEN REFUSING TO FALL!!!! JAMIE IS GAINING THE ADVANTAGE!!!! THERON DROPS HIS HANDS AS JAMIE PUSHES HIM BACK AGAINST THE ROPES!!! JAMIE FIRES WITH A SHOOT KICK TO THE CHEST!!! ANOTHER!!! ANOTHER!!!! ANOTHER!!!!! THERON LEANING AGAINST THE ROPES; THEY’RE THE ONLY THING KEEPING HIM STANDING!!!! JAMIE DRAGS THERON OUT OF THE CORNER AND PULLS HIM IN!!!!

Talib: JAMIE IS TRYING TO HOOK THAT LEG, BUT THERON TWISTS OUT OF IT!!!! BICYCLE KNEE FROM THERON!!! IT MISSES!!!! SUPERKICK FROM O’HARA!!!! THERON FALLS FORWARD AND INTO THE ARMS OF O’HARA!!!! JAMIE HAS HIM HOOKED!!!! DEATH, DECAY AND WINDY DAYS!!!!! SPINNING FISHERMAN BUSTER!!!! JAMIE ROLLS BACK THROUGH AND KEEPS THERON HOOKED!!!! JAMIE POWERS THERON BACK TO HIS FEET – WOW!!!! THERON POPS JAMIE INTO THE AIR AND ABSOLUTELY NAILS HIM ON THE JAW WITH A VERY EUROPEAN UPPERCUT!!! JAMIE FALLS BACK, BUT THERON CATCHES HIS ARM AND PULLS HIM IN!!! THERON POWERS HIM UP TO HIS SHOULDERS AND POWERS HIM DOWN WITH A POWERBOMB!!! THERON HOLDS THE COVER!!!!

ONE!!!!!!!!… TWO!!!!!!!!… KICKOUT!!!!

Stew: JAMIE KICKS OUT, BUT THERON USES THE MOMENTUM OF THE KICK OUT TO ROLL JAMIE ONTO HIS KNEES!!!! WHAT A KNEELIFT!!!! THERON DRIVES HIS KNEE DIRECTLY INTO THE JAW OF JAMIE O’HARA!!!!! THERON COVERS AGAIN!!!!

ONE!!!!!!!… TWO!!!!!!!… KICKOUT!!!!!

Stew: KICKOUT AGAIN FROM O’HARA!!!!

Talib: THIS TIME THERON DOESN’T WASTE AN INCH!!!! THERON DRAGS JAMIE BACK TO HIS FEET!!!! THERON PULLS JAMIE IN AND POWER UP!!!!! KING’S REQUIEM!!!!

Stew: NO!!!! JAMIE TWISTS IN MID AIR AND COUNTERS INTO A STUNNER!!!!! THERON IS DAZED, BUT HE REFUSES TO FALL!!!! JAMIE PUSHES HIMSELF BACK TO HIS FEET AND SHOOTS TOWARDS THE ANSWERS WORLD CHAMPION!!!! JOHN WOO DROPKICK!!!! THERON SENT THROUGH THE ROPES AND ONTO THE APRON!!!! THAT KNEE IS CATCHING UP TO THE CHALLENGER; THE PAIN SHOOTING ACROSS HIS FACE WITH EACH STEP HE TAKES!!!! THERON IS BACK TO HIS FEET AS JAMIE SPRINGBOARD OFF THE MIDDLE ROPE AND BACK OVER THE TOP ROPE INTO THERON!!!! THERON CAUGHT HIM!!!! JAMIE CAUGHT IN THAT FIREARM’S CARRY POSITION!!!!

Talib: JAMIE FIGHTS!!!! JAMIE DRIVES HIS ELBOW INTO THE SIDE OF THE ANSWERS WORLD CHAMPION’S HEAD!!!! A SECOND ELBOW!!!! A THIRD!!!!! JAMIE WILL NOT STOP!!!! JAMIE FIGHTS BACK DOWN TO HIS FEET AS THERON DROPS TO A KNEE!!!! JAMIE DOESN’T RELENT!!!! THERON’S HEAD RESTING AGAINST THE LEG OF JAMIE O’HARA!!!!! JAMIE LOOKS DOWN AT THE ALMOST UNMOVED THERON NIKOLAS!!!! DISGUST AND HATRED IN ITS PUREST FORM PLASTERED ACROSS HIS FACE!!!!! JAMIE PULLS HIM IN!!!! YOU’LL BREAK THE MAN’S NECK, JAMIE!!!!! NO WAY!!!!

Stew: JESUS FREAKING CHRIST!!!! DESTINATION FUCKED!!!!!! JAMIE O’HARA DRIVES THERON NIKOLAS INTO THE APRON WITH A CANADIAN DESTROYER!!!! THERON IS NOT MOVING!!!!! THIS IS JAMIE’S MOMENT!!!! THIS IS HIS OPPORTUNITY TO RECLAIM HIS SPOT AT THE TOP OF EAW!!!!! JAMIE ROLLS OFF THE APRON AND PUSHES THERON BACK UNDER THE BOTTOM ROPE!!!! THERON HAS NO MOVED AN INCH!!!! JAMIE FORCES HIMSELF BACK ONTO THE APRON!!!!! JAMIE BEGINS TO MAKE THAT CLIMB TO THE TOP!!!! JAMIE’S HUFFING, PUFFING, WHEEZING; THE MAN IS ABSOLUTELY EXHAUSTED, BUT HE CAN SEE THE FINISH LINE!!!! JAMIE FINALLY REACHES THE TOP ROPE AND STEADIES HIMSELF!!!!! GENKI CANNON!!!!!!!!!!!!!! IT CONNECTS!!!!!!! DOUBLE FOOTSTOMP TO THE ANSWERS WORLD CHAMPION!!!!!

Talib: JAMIE CLUTCHES STRAIGHT AT HIS KNEE!!! JAMIE TRYING TO DRAG HIMSELF INTO THE COVER!!!! HE CAN TASTE IT!!!! JAMIE’S THERE!!!! THE REFEREE COUNTS!!!!!!

ONE!!!!!!!… TWO!!!!!!!… THREE!!!!!!! KICKOUT!!!!!

Stew: IT. IS. NOT. ENOUGH.

Talib: THERON GOT HIS SHOULDER ONLY A FEW INCHES OFF THE CANVAS, BUT IT’S ENOUGH!! JAMIE JUST ROLLING AWAY; HE GRABS STRAIGHT BACK AT THE KNEE!!! WHAT DAMAGE HAS HE FURTHER DONE?? THE CHALLENGER FORCING HIMSELF BACK TO HIS FEET AND BACK INTO THE CORNER!!!! JAMIE PULLS DOWN HIS KNEE PAD; JAMIE MAY BE INTENDING TO MAKE SURE THAT THE CHAMPION NEVER GETS BACK UP!!!! THERON ROLLS ONTO HIS STOMACH AND STARTS DRAGGING HIMSELF TOWARDS JAMIE!!!! HE’S SMILING? THERON PUSHING HIMSELF BACK TO HIS FEET – IN EXCELSIS!!!!!! SUPERKICK!!!!!! JAMIE CAUGHT IT!!!!! THERON TRYING, BUT FAILS – NO!!!! THERON USES HIS OTHER LEG AND DRIVES HIM BOOT INTO THE DAMAGED KNEE OF O’HARA!!!!

Stew: JAMIE RELEASE THE LEG OF THERON AND DROPS TO A KNEE!!!! SCISSORS STOMP!!!! BOOT TO THE BACK OF THE HEAD OF O’HARA!!!! DISCUS FOREARM!!!! CRACK TO THE JAW OF THE CHALLENGER!!!!!! SUPERKICK!!!!!!! JAMIE STILL STANDS, BUT BARELY!!!! THERON HAS HIM!!! SNAP DRAGON SUPLEX!!!!! JAMIE DRIVEN DIRECTLY ON THE BACK OF HIS HEAD AND NECK!!!! JAMIE STAGGERS BACK UP, BUT STRAIGHT INTO THE ARMS OF THERON!!!! THERON PULLS HIM IN AND POWERS HIM UP!!!! HE HAS HIM SET!!!! KING’S REQUIEM!!!!!! JAMIE COUNTERS INTO THE STUNNER AGAIN!!!!!

Talib: BUT, THIS TIME THERON IS PREPARED!!!!! THERON BLOCKED IT AND CATCHES O’HARA IN THAT SLEEPER HOLD!!!!! JAMIE IS IN A PANIC!!!! JAMIE TRYING TO SCRAMBLE, BUT IT’S ONLY MAKING THINGS WORSE!!!!!

Theron: KNEEL.

Stew: JAMIE TRYING TO FIGHT, BUT HE JUST DOESN’T HAVE THE ENERGY!!!! JAMIE IS FADING!!!!

Theron: KNEEL.

Stew: COME ON, JAMIE!!!! THERON APPLIES MORE PRESSURE!!!!! JAMIE’S FACE TURNING ABSOLUTELY BEET RED!!!!! JAMIE COLLAPSES DOWN TO HIS KNEES!!!!!!

Talib: THE FIRST PIECE TO THE END COMPLETE!!!!! HAIL TO THE KING!!!!!!! KNIFE EDGED ELBOW TO THE BACK OF THE HEAD OF O’HARA!!!!!!! THERON DROPS TO THE CANVAS IN COMPLETE EXHAUSTION!!!! HE’S SLOWLY DRAGGING HIMSELF INTO THE COVER!!!!! HE HOOKS BOTH LEGS!!!!!

ONE!!!!!!!… TWO!!!!!!… THREE!!!!!!!!!

(Ding! Ding! Ding!)

(“I Hope You Suffer” – AFI hits as Theron rolls off Jamie as the crowd stands on their feet.)

Stephie Love: THE WINNER OF THIS MATCH… AND STILL THE ANSWERS WORLD CHAMPION!!!!

Talib: I’m lost for words…

Stew: We said this was going to be a classic and they delivered. You just can’t doubt the Answers World Champion. Jamie gave him everything he can handle and came out STILL the champion.

Talib: What a start to King of Elite! This is only the beginning! We still need to crown a new King! We have four more main event matches to get through, and other incredible matches. If this match is anything to go by, we are in for a show that we are going to remember forever. Do not miss a second, you do NOT want to miss a second.

(Theron gets back to his feet and is handed the Answers World Championship; he stands over Jamie and raises the AWC as boos roar down. Theron rolls out of the ring and limps up the ramp as Jamie recovers in the ring as the camera fades out.)

Gina Romano: THE FOLLOWING CONTEST IS SCHEDULED FOR ONE FALL–

Neckbeards: ONE FALL!!!!

Gina Romano: …AND IS A STREET FIGHT FOR POSSESSION OF THE CASH IN THE VAULT BRIEFCASE!!

“I GOT, YOU WANT.
IT’S JUST, DON’T STOP.
I GOT, YOU WANT.
IT’S JUST, DON’T STOP.”

“THIS IS ENTERTAINMENT.
LIES ARE ENTERTAINMENT.
YOU ARE DOWN ON YOUR KNEES…
BEGGING ME FOR MORE! ”

(The hook for “Don’t Stop” by InnerPartySystem rips through the sound system and that is the cue for Noah Reigner to walk out onto the stage, followed by Evelyn Ridley. Noah stops on top of the ramp, his eyes scanning the crowd as the verses of the song begin to take over.)

Gina Romano: Making his way to the ring.. Being accompanied by Evelyn Ridley..from Seattle, Washington, weighing at 184 pounds. He is THE ASSAULT RIFLE… NOOOAHHH REEEEIIIGNNNNEERRR

Deadprez: This is not the same Noah Reigner we all know. What you all see in front of you is a man that has had his life taken away from him. His chance at the world championship. He is in a state of pure anger and it’s all thanks to this man..

(“Love SOSA” by Chief Keef starts playing as the entire arena erupts into boos, which only grow louder as SOSA Henderson makes his way out onto the stage. SOSA walks down to the ring slowly as Gina introduces him.)

Gina Romano: And his opponent.. from Philadelphia.. Weighing in at 191 pounds.. BULLETPROOF, SOOOSSAAAA HEENNNDDEERRSOOONNNN!!!!

Eve: These fans hate SOSA Henderson just as much as Noah Reigner does, but SOSA doesn’t care. He has a goal in mind, and that’s to keep that contract, the contract that he stole.

Deadprez: The two now getting too close to each other and the referee has to get them away before this turns into an all out brawl, meanwhile Evelyn is at ringside in Noah’s corner.

(Ding! Ding! Ding!)

Deadprez: The bell has rung AND NOAH RUNS RIGHT AT SOSA, AND THE TWO ARE THROWING HANDS AT EACH OTHER!! NOAH PUSHES SOSA INTO THE CORNER AND NOW HE’S JUST THROWING EVERYTHING AT HIM!!! NOAH NOW STOMPING HIM OUT AND THIS MATCH IS OFF TO A BIG START!! Noah now is dragging SOSA to his feet, and he throws him to the ropes! KILLSHOT!! NO! SOSA holds on to the ropes, and the kick doesn’t connect! SOSA now rolls out of the ring, and it looks like he doesn’t quite know what to do yet, but he has to figure it out because Noah is running at him! SUICIDE DIVE BY NOAH!! Noah runs back into the ring and it looks like he wants another! SOSA slowly gets to his feet and Noah charges at him once again! SUICIDE DI- OH!! OH MY GOD!!! SOSA STRIKES NOAH IN THE HEAD WITH A KENDO STICK!!! NOAH’S OUT!!

Eve: Noah is out of it like you said, and SOSA now, dragging Noah up, and he just throws him into the steel steps! SOSA stopping now to take a breath, but now he’s grabbing something else from under the ring. AND IT’S A STEEL CHAIR!! SOSA now, oh no! Sosa is setting the steel chair around Noah’s neck, and what’s he trying to do? SOSA drags Noah to his feet, AND THROWS HIS HEAD INTO THE STEEL STEPS!! THAT STEEL CHAIR JUST CRUSHED NOAH’S THROAT, AND SOSA BRINGS HIM INTO THE RING FOR A COVER!!

ONE!
TWO!!
T-

Eve: NOAH KICKS OUT!! SOSA now just kicking the face of Noah. SOSA now though dragging Noah to his knees, and he just slaps him in the face! This is blatant disrespect and clearly SOSA doesn’t care, and he’s now he’s going after that steel chair again, as well as the Kendo stick. SOSA now wedging the chair into the turnbuckles, but he keeps the kendo stick in hand. SOSA drags Noah to his feet and he attempts to throw Noah into the chair BUT NOAH SENDS SOSA INTO IT INSTEAD!! SOSA JUST WENT HEAD FIRST INTO A STEEL CHAIR, AND NOW NOAH’S GOT THE KENDO STICK!! Noah now slowly walks up to Sosa, who’s seated down in the corner, AND NOW HE’S CHOKING HIM WITH THE KENDO STICK!!

Deadprez: Noah now moves the kendo stick from his throat, and as SOSA attempts to get away, NOAH WHACKS HIM IN THE BACK WITH IT!! HE DOESN’T STOP THERE THOUGH!! NOAH IS DESTROYING THE BACK OF SOSA WITH THAT KENDO STICK AND LOOK AT THAT!! THE KENDO STICK HAS BROKEN IN HALF!! Just look at the marks on the back of SOSA! He brought this on himself, and Noah now is bringing SOSA to our commentary desk, and he slams him face first onto it! Noah now, THROWING SOSA FACE FIRST INTO THE RING POST!! Noah now taking a step back and he’s holding his throat, still hurt after what SOSA did a little while ago with that steel chair! SOSA is trying to stand his ground but now Noah catches him with a knee lift! SOSA now is, trying to crawl over the barricade!? SOSA is trying to get over the barricade into the EAW universe, but Noah is there to stop his tracks, hitting him straight in the jaw with a left hand! Noah now, climbing on top of the barricade himself, and what’s he doing? He drags Sosa up, and what’s Noah thinking? ROGUE CUTTER OFF THE BARRICADE!!

Eve: WOW!! SOSA is out of it! Noah just hit the Rogue Cutter from off the barricades!!! That’s amazing! Now Noah is just getting in the face of Sosa.

Noah: YOU DID THIS!! THIS IS ALL YOUR FAULT!!

Eve: Noah now grabbing the steel chair from before, and it looks like he’s waiting for SOSA to move. SOSA though is trying to crawl his way to the steel steps to get himself up, BUT NOAH HITS HIM IN THE BACK WITH THE STEEL CHAIR!! SOSA isn’t even able to stand! Noah now is just dragging Sosa up the ramp and one could only wonder why! Noah is dragging Sosa up the ramp, AND HE THROWS HIM RIGHT INTO THE MINITRON!! SOSA has been getting pummeled by Noah and The Assault Rifle still isn’t finished with him! Reigner now is dragging SOSA to the crowd, showing them the pain and agony the “King if Philly” is in, BUT SOSA WITH A LOW BLOW!!! SOSA now crawling backstage, meanwhile Noah is down!

Deadprez: SOSA now is backstage and I have no idea where he’s crawling to, but Noah is slowly following as the Bulletproof gets to his feet. Noah is slowly trailing behind, but he now finds himself leaning by a table in pain.

Noah: WHERE ARE YOU SOSA!? WHERE ARE YOU!?

Deadprez: Noah now is limping backstage on his search for SOSA, BUT THAT DOESN’T LAST LONG AS SOSA FLOORS HIM WITH A GARBAGE CAN!! SOSA just floored Noah and now he’s dragging him through backstage, and there’s the parking lot! SOSA drags him to his feet and Noah’s trying to fight SOSA off, but he doesn’t even know where he is! Noah throwing lefts and rights wildly AND SOSA NOW DROPS HIM WITH A BICYCLE KNEE!! SOSA now is dragging Noah over towards one of the cars and he attempts to slam him into the car hood, but Noah stops himself with his foot, before hitting a hard elbow to the jaw of SOSA! Noah steps back and takes a breath, before charging at SOSA AND DELIVERING THE KILLSHOT!!! Noah just floored SOSA with the killshot!

Eve: Yeah but now Noah is struggling to get up himself! Having to use the car to even stand, but Noah now has to bring SOSA back to the ring! Noah slowly drags SOSA to his feet but he’s not bringing him out the parking lot! He’s.. He’s.. OH MY GOD!!! NOAH JUST, HE JUST TOSSED SOSA HEAD FIRST INTO THE CAR WINDOW!! SOSA JUST HAD HIS HEAD FILLED WITH GLASS!! Noah now is throwing SOSA on top of the car, and you’ve got to feel bad for whoever owns this car!

Deadprez: You sure do, SOSA on the other hand, you can’t say he didn’t have this coming. Nonetheless though, Noah now holds SOSA up in a Suplex position! AND NOAH WITH THE HOUSE EDGE ON THE CAR ROOF!!! SOSA IS DONE!! THERE’S NO WAY HE CAN COMPETE, AND NOAH NOW DRAGS THE BODY BACK FROM THE PARKING LOT!!

Eve: Now Noah has to drag the body of Sosa back to the ring, but slowly it looks like he’s capable of doing just that! Noah now reaches the stage, and he’s just dragging the lifeless SOSA down the ramp now, before leaving him at ringside. Noah now, grabbing the steel steps and putting it in the ring! Noah now rolls SOSA into the ring, and I just wonder where he’s going with this. Noah now is powering SOSA onto the top rope, and he’s climbing up with him, with the steps sitting in the middle of the ring. Noah, goit for the.. No! ROGUE CUT- SOSA PUSHES HIM OFF!! SOSA PUSHES NOAH OFF THE TURNBUCKLES AND NOAH LANDS RIGHT ON THE STEEL STEPS!! SOSA IS STILL ON THE TOP ROPE AND HE’S GETTING READY!! SOSA BOMB CONNECTS!!! SOSA FALLS INTO THE COVER!!!

OOOOOONNNNEEEEE!!
TTTTWWWOOOOOOOOOOO!!!!
THHHHRRRREEEEEEEEEE!!!!!!

Eve: NOAH GETS THE SHOULDER UP!!! HE KICKED OUT!!! SOSA now is just in pure agony and distraught, he can’t believe it! Noah wanted to hurt SOSA, torture him even, and that nearly cost him this match, but no! Noah is still in it, meanwhile SOSA now is using the ropes to pull himself to the outside of the ring, and now he’s going towards the timekeepers area, and he has the ring bell! SOSA now rolling back into the ring, and he’s leaning in the corner, waiting for Noah to get to his feet but there’s no response by him. SOSA now drops the bell and he picks up the steel steps instead, setting it up into the corner, before dragging Noah into that corner.

Deadprez: SOSA now just slamming the head of Noah into the steps! This match has just been brutal so far! SOSA now pulling Noah up to his feet and attempts to throw Noah into the corner, but Noah once again stops himself and elbows SOSA in the midsection, causing him to stumble back. Noah now picks up the ring bell as SOSA turns back around, AND NOAH DRIVES IT RIGHT INTO HIS FACE!!! Neither man are willing to give up this match, this match means too much to them, especially for Noah! SOSA did something nobody has ever done to Noah! SOSA made Noah into a bitter man, a man filled with nothing but rage, and Noah here wants nothing more than to take all that rage out on SOSA! Noah now is just beating in the head of SOSA with that ring bell, someone has to do something!

Eve: They can’t do anything, it’s no disqualification, anything goes, but the referee clearly forgot as he’s trying to break the two apart!

Noah: What are you doing!? It’s no DQ! What are you doing!?

Deadprez: Noah now pushes the referee out of anger and I don’t know if that’s a smart thing to do here. SOSA now is getting lifted to his feet by Reigner, and Noah picks him up in a powerbomb position, BUT SOSA WITH THE SUNSET FLIP!! HE ROLLS HIM UP!!!

OOOOONNNNNNNEEEEEE!!
TTTTTWWWWWOOOOOO-

Deadprez: NOAH REVERSES IT INTO HIS OWN ROLL UP!! HE COUNTERED IT!!! THE COVER BY REIGNER!!

OOOOOONNNNNEEEEEEE!!!!
TTTWWWOOOOOOOOOOO!!!!
TTTTTHHHHHHRRRREEEEEEE!!!

Deadprez: KICK OUT BY SOSA!! Noah backs up now and he’s waiting for SOSA to get to his feet! NOAH HITS THE KILLSHOT ONCE AGAIN, SENDING SOSA OUT OF THE RING!!! Noah now following right behind SOSA, and he grabs the “Bulletproof” SOSA, AND THROWS HIM OVER THE BARRICADE!! Noah follows behind, and Noah now is beating down SOSA right in front of all those fans! Noah is dragging SOSA up the stairs, and you’ve got to wonder how far Noah is willing to go. Noah now still dragging SOSA with him, but SOSA now, pulls Noah and THROWS HIM DOWN THE STAIRS!! Noah just dropped down the stairs, and what’s SOSA doing? He runs down a few of the steps, AND JUMPS RIGHT OFF OF THEM!! HE HITS THE SOSA BOMB OFF THE STAIRS!!! BOTH MEN ARE FLOORED AT THE BOTTOM OF THE STAIRS, WITH THOUSANDS OF FANS AROUND THEM TO SEE IT ALL HAPPEN!! Say what you will about SOSA Henderson but what he just did, that takes more than guts!

Eve: These two have put their bodies on the line for this match, and still, they just won’t quit. They won’t give up, but now the two are just laying their, two immobile bodies, meanwhile the referee is coming to see if they’re even breathing. The referee now checking the two men, but SOSA pushes him away as he manages to get to his feet with one of the chairs next to him. SOSA now drags Noah over the barricade before hopping over it himself, and he’s now bringing him towards the ring. SOSA rolls Noah back into the ring as he slowly follows behind, and now he slides into the cover, and I think this one’s over!

OOOONNNNNNEEEEEEEE!!!
TTTTTTWWWWWWOOOOOOO!!!!
TTTHHHHHRRRREEEEEEEEEEEE!!!!!

Eve: WOW!!! ANOTHER KICK OUT BY NOAH!!! SOSA CAN’T BELIEVE WHAT HE’S SEEING, THE RESILIENCE ON DISPLAY BY NOAH!! SOSA is climbing up to the top rope now, and I’m sure he wants this to be the last time! PAID IN FULL, WAIT, NOAH ROLLS OUT OF THE WAY!! AND THERE’S THE SHOT DOWN!!! THE JUMPING UNDERHOOK DDT CONNECTS!!! NOAH COVERS SOSA NOW!!

OOOOOONNNNNNEEEEEEEE!!!
TTTTTTTTWWWWOOOOOOO!!!
TTTTTHHRRRRREEEEEEEE-

Eve: WHAT!?

Deadprez: NOAH JUST LET GO OF THE PIN!? WHAT’S NOAH DOING? Noah now dragging SOSA to his feet and he’s looking him straight in the eye! WAIT!! AND THERE’S THE CROSSFACE CHICKENWING!! NOAH LOCKS IN THE CROSSFACE CHICKENWING ON SOSA!!! SOSA’S IN TROUBLE, HE COULD TAP RIGHT HERE!!! SOSA IS GRABBING THE ROPES BUT THIS IS A NO DISQUALIFICATION MATCH!! THERE ARE NO ROPE BREAKS!! SOSA is pulling the rest of his body to the ropes but I don’t know if this can help him!

Eve: SOSA now is pulling himself under the bottom rope, and he finally gets out of the hold as he falls outside the ring! Noah now just sitting in the ring, and it looks like he’s just waiting for SOSA to get to his feet, but look! Evelyn Ridley now is holding SOSA up! Evelyn is helping Noah here as he’s now grabbing that steel chair that’s in the ring! What’s Noah thinking now? WAIT NOAH!! SUICIDE DIVE WITH THE STEEL CHAIR!!! Noah has been on fire in this match and now he needs to finish SOSA off, but he’s just slamming the steel chair all over him! Noah now dragging SOSA to his feet, and he’s rolling him back into the ring, AND NOW HE’S CHOKING SOSA WITH THE ROPES!! I don’t know if SOSA can come back from this, Noah could have ended this match long ago but he wants to hurt SOSA, torture him even! Noah now irish whipping SOSA into the corner and he charges in for a knee strike but SOSA gets out of the way! Noah now turns around RIGHT INTO A JUMPING DDT!! BOTH MEN ARE DOWN BUT CAN SOSA GET TO THE COVER!?

Deadprez: SOSA now is crawling to the ropes, and he’s using them to try and pull himself up. SOSA’s just waiting for Noah to get to his feet, he just wants to finish this! Noah is reaching out for the ropes, pulling himself up but he’s still leaning on them, but SOSA charges in anyway, but NOAH WITH THE ROGUE CUT- NO, SOSA PUSHES HIM AWAY AND ATTEMPTS AN ENZUIGIRI, BUT NOAH DUCKS IT!! NOAH NOW LOOKING FOR THE HARD GOODBYE, BUT SOSA TURNS IT INTO A CRUCIFIX PIN!!

OOONNNNNEEEEEE!!
TTTTTTTTWWWWWOOOOOO!!!
THHRRRRREEEEEEEEEEEEEE

Deadprez: NOAH GETS OUT OF IT AND SOSA HITS A SUPERKICK AS NOAH WAS ON HIS KNEES!! SOSA COVERS HIM ONCE MORE!!!

OOOOOOONNNNNNEEEE!!
TTTTTTTTWWWWWWOOOO!!
TTTTTHHHHRRRREEEEEEE!!!

Deadprez: NOAH WITH ANOTHER KICK OUT!!! SOSA now with an evil look in his eye as he goes out the ring to get that steel chair, but wait! TURN AROUND SOSA!! OH MY GOD!! EVELYN RIDLEY WITH A CHAIR SHOT TO SOSA’S SKULL!! AND NOW SHE ROLLS HIM INTO THE RING!! NOAH IS GETTING TO HIS FEET AS SHE TELLS HIM TO FINISH THE MATCH!!! NOAH PICKS SOSA UP!! THE HARD GOODBYE!!! THAT’S IT!!! THE COVER NOW BY NOAH!!!

OOOONNNNNNNNEEEE!!!
TTTTTTTTTTTWWWWWWWOOOO!!!
THHHHHRRRRREEEEEEEEEEE!!!

(Ding! Ding! Ding!)

Gina Romano: HERE IS YOUR WINNER… NOOOAAAHHHHH RRRREEEIIIGGNNNEERRRR!!!!

Deadprez: HE DID IT!! NOAH GETS THE BRIEFCASE!! NOAH GETS BACK WHAT WAS HIS THANKS TO EVELYN RIDLEY!!

Eve: These two went to town on each other! This is a fight neither man will remember, but in the end Noah Reigner is once again Mr. Cash in the Vault!

(Noah has his hand raised by Evelyn Ridley as he is given the CITV briefcase, and SOSA sits outside the ring, bloodied, sweaty, hurt, and disappointed.)

(“F.U.U.” — Dream Wife blasts through the speakers as the crowd gives a negative reaction to Sienna Jade who walks out with confidence. Sienna is looking around the sold out crowd in FNB Stadium as she gestures for the Women’s World Championship on her waist. She makes it down the ramp as she is trash talking the crowd.)

Gavin Kirkland: Exactly one year ago, Sienna Jade ruled on top of the Freeweight Division in REVOLT Pro Combat as Freeweight Champion! From that night, people could not get enough of Sienna Jade! She had a classic matches with Ms. Extreme and Lexi Sheckler! People were expecting great things out of Sienna in Elite Answers Wrestling, but all it took was one match against Stephanie Matsuda at Pain for Pride Festival for Sienna’s world to go upside down!

CJ Hana: Ever since that loss, Sienna Jade had wondered why she was never given the rematch she believed she was rightful of? Sienna was instead tossed aside as people who she would be forgotten, but Sienna was someone who refused to be in the background! She blamed EAW management, which is kinda ironic since she is nothing more than one of their favorites, but Sienna has her title shot and the last thing she needs to do is drop the ball on it!

(“Party Goin’ Dumb” — Rico Nasty replaces “F.U.U.” as the crowd stands up in a positive reaction as Astraea Jordan steps on top of the ramp! Front and center, you can see the Empress of Elite crown on the top of her head. She poses for the crowd before hyping them up and making her way down to the ring.)

CJ Hana: Astraea Jordan is also a woman who has been waiting for her shot at the Women’s World Championship! She was supposed to get this match at Road to Redemption, but Raven’s Roberts’ performance at Bloodletter overshadowed Astraea and pushed her title shot to King of Elite. I don’t think Astraea was quite happy about that! Astraea believes that all eyes should be on her! That she should be the main focus of Empire!

Gavin Kirkland: Astraea Jordan’s title match being pushed to King of Elite was nothing more, but business! They needed a match at Road to Redemption that was money making and Astraea as Madison’s opponent had no dollar signs! Plans change constantly! This is wrestling! Nothing is predetermined!

(“O Fortuna” — Carl Orff replaces “Party Goin’ Dumb” as the crowd explodes in boos as Madison Kaline steps on top of the ramp. The Women’s World Championship is on her waist as she looks at the fans booing her as she skips down the ramp.)

Gavin Kirkland: HERE IS OUR BEAUTIFUL AND BLONDE WOMEN’S WORLD CHAMPION! Madison Kaline has been such a wonderful champion and she has gotten some solid victories in her reign! However, she steps into a tough title defense against two women who are more than hungry to take this championship away from her! These women have been waiting MONTHS to get their title match!

CJ Hana: Madison Kaline has relied on Amber Keys and Cleopatra to help her out in the past, but I don’t think that Madison is going to be so lucky in this match!

(Maria Del Rey stands in the center of the ring. Astraea Jordan, Madison Kaline and Sienna Jade are standing in a triangle formation as they wait for their introductions.)

Maria Del Rey: The following match is a TRIPLE THREAT MATCH and it’s for the ELITE ANSWERS WRESTLING WOMEN’S WORLD CHAMPIONSHIP! Introducing the challengers, first, representing Jaded Wolfe Hearts, from San Diego, California, she calls herself “Unfuckwithable”, SIEEEENNNNNNNNNNNAAAAAAAA JAAAAAAAADDDDDDDDDEEEEEEEE!!

(The crowd boos as Sienna Jade steps front and center and gestures for the title on her waist. She looks at Madison Kaline and Astraea Jordan before making her way back to her respective corner.)

Maria Del Rey: Introducing her opponents, first, from Chicago, Illinois, she is the “Empress of Elite”, ASSSSSSTRRREEEAAAAEEEAAAAAAAAA JOOOOOOORRRRRDDDDAAAAANNNNNN!!
(The crowd gives a positive reaction as Astraea Jordan takes front and center before raising her Empress of Elite crown high in the air and points at Madison Kaline and the Women’s World Championship before making her way back to her area.)

Maria Del Rey: Introducing last, representing The Queen’s Court, from Tampa Bay, Florida, she is the CURRENT ELITE ANSWERS WRESTLING WOMEN’S WORLD CHAMPION, “THE QUEEN OF DEATH”, MAAAAADDDDDDISSSSSSOOOOOOOONNNNNN KAAAAAALIIIIINNNNNNNNNEEEEE!!

(Madison Kaline raises the Women’s World Championship high in the area as the crowd explodes in boos! Madison is crackling as she hands Marti Solo, the official of the match, the title. Marti raises the title high in the air to let these people what the three women are fighting for. Marti shows Astraea Jordan and Sienna Jade the Women’s World Championship before she gives it off to the time keeper before calling for the bell!)

(Ding! Ding! Ding!)

CJ Hana: THIS IS ONE MATCH I HAVE BEEN WAITING FOR THESE PAST FEW WEEKS, GAVIN! MADISON KALINE FACES HER BIGGEST CHALLENGE AS WOMEN’S WORLD CHAMPION! SHE NOT ONLY HAS TO WORRY ABOUT THE EMPRESS OF ELITE, ASTRAEA JORDAN, BUT A FORMER FREEWEIGHT CHAMPION IN SIENNA JADE! MADISON KALINE HAS BEEN SICK OF TIRED OF PEOPLE BELIEVING THAT THE BOARD PROTECTING HER IS THE REASON WHY SHE IS WOMEN’S CHAMPION. SHE IS SOMEONE WITH THE MOST TO PROVE IN THIS MATCH TONIGHT. SHE CAN EITHER WALK OUT OF THE FNB STADIUM WITH THE TITLE IN HER CLUTCHES OR ONE OUT OF HER TWO TALENTED OPPONENTS WILL HAVE NO PROBLEM WITH RIPPING THAT CHAMPIONSHIP OFF HER HANDS! ASTRAEA JORDAN IS SOMEONE WHO HAS BEEN WAITING FOR THIS MATCH SINCE AUGUST! SHE HAS WAITED ALMOST SIX MONTHS FOR THIS OPPORTUNITY! SHE WAS SUPPOSED TO HAVE THIS CHAMPIONSHIP OPPORTUNITY AT ROAD TO REDEMPTION, BUT THE SHE WAS OVERSHADOWED BY RAVEN ROBERTS AND HER PERFORMANCE AT BLOODLETTER. AT LAST, ASTRAEA GETS HER CHAMPIONSHIP OPPORTUNITY AND A YEAR AFTER HER DEVASTATING LOSS AGAINST ARIA JAXON. ASTRAEA IS LOOKING TO REDEEM HERSELF FROM THAT EVENT. LASTLY, SIENNA JADE IS SOMEONE WHO NEVER RIGHTFULLY GOT HER REMATCH WHEN SHE LOST THE FREEWEIGHT CHAMPIONSHIP TO STEPHANIE MATSUDA IN A TITLE UNIFICATION MATCH AT THE PAIN FOR PRIDE FESTIVAL. SIENNA WAS JUST THROWN ASIDE LIKE YESTERDAY’S TRASH, BUT KENDRA SHAMEZ GRANTED HER THE OPPORTUNITY TO BE PLACED INTO THAT MATCH AND SHOW THE WORLD THAT SHE IS THE BEST DAMN THING TO COME FROM REVOLT! PRO COMBAT!

Gavin Kirkland: These three women are all looking at each other. None of them want to take their eyes off the other because it will allow anyone to deliver the first blow in this match! The crowd in Johannesburg, South Africa is on the edge of their seats for what is going to be a great battle between these three beautiful and strong women! Wait a minute?

CJ Hana: Madison Kaline slides underneath the ring! She is wanting no part in this match! From what I can recall, this is the same strategy that Sienna Jade had at Terminus last year, in the Freeweight Triple Threat Match! Madison is tapping her temple with her finger! Madison believes that she may be the smartest woman in this match, but Sienna Jade exits the ring and goes after so-called “Queen of Death”. Sienna is walking towards Madison, who is slowly backing away, she wants no part of Sienna!

(Madison Kaline backs away from Sienna Jade until Madison bumps into something behind her. Madison turns around…)

Gavin Kirkland: OH MY LORD! ASTRAEA JORDAN PAYS TRIBUTE TO MR. DEDEDE WITH A SPEAR! MADISON KALINE IS TAKEN OUT SO EARLY INTO THIS MATCH! MADISON LOOKS LIKE SHE HAS HAD THE AIR TAKEN OUT OF HER AS SHE FALLS TO THE GROUND INSTANTLY! SIENNA JADE GOES RIGHT AFTER ASTRAEA AND BEGINS TO DELIVER SOME SERIOUS SHOTS ONTO THE FACE OF ASTRAEA, BUT ASTRAEA JORDAN IS ANSWERING EACH OF THOSE SHOTS WITH HER OWN! BOTH THESE WOMEN BATTLED OVER THE FREEWEIGHT CHAMPIONSHIP IN THE PAST! ASTRAEA WAS SO CLOSE TO WINNING THAT FREEWEIGHT CHAMPIONSHIP AWAY FROM SIENNA! ASTRAEA HAS BEEN SO CLOSE TO WINNING THESE TITLES AND SHE REFUSES FOR KING OF ELITE TO BE ANOTHER ONE OF THOSE TIMES! ASTRAEA TRADES IN THOSE SHOTS AS SHE DELIVERS A KNEE TO SIENNA’S GUT! ASTRAEA GETS SIENNA BY HER HAIR BEFORE SMACKING HER HEAD AGAINST THE APRON! SIENNA STUMBLES BACK A BIT BEFORE CONNECTING WITH AN AXE HANDLE CLOTHESLINE AS THAT FLOORS SIENNA INSTANTLY! ASTRAEA IS NOT LETTING SIENNA BREATHE FOR A SECOND! SHE GETS SIENNA JADE AND ROLLS HER BACK INSIDE THE RING! ASTRAEA STEPS INSIDE THE RING AFTER! ASTRAEA SEES SIENNA RISING BACK TO HER FEET! ASTRAEA WITH A DROPKICK THAT MAKES SIENNA FALL TO HER KNEES! ASTRAEA GETS SIENNA BY HER RIGHT ARM BEFORE WHIPPING HER TO THE CORNER!

CJ Hana: Sienna Jade goes crashing to the corner as Astraea Jordan goes running towards Sienna and connects with handspring back elbow! No! Sienna Jade manages to move out of the way! Astraea goes crashing against the ropes! Sienna connects with a springboard roundhouse kick! Astraea stumbles a bit before Sienna pulls her in and connects with a DDT! ASTRAEA GOES FACE FIRST AGAINST THE MAT AS SIENNA HAS A DEVIOUS SMIRK ON HER FACE! I DON’T THINK THAT I HAVE SEEN THIS SIENNA IN A LONG TIME! THIS SIENNA JADE REMINDS ME OF THE WOMAN WHO MANAGED TO WIN THE FREEWEIGHT CHAMPIONSHIP IN REVOLT 1! SHE IS THE SIENNA JADE, WHO HAD THE FREEWEIGHT DIVISION IN THE PALM OF HER HAND! SIENNA GETS ASTRAEA’S LEFT ARM BEFORE CONNECTING WITH A SINGLE ARM DDT! IN RESPONSE, ASTRAEA CLUTCHES TO THE ARM! IT SEEMS LIKE SIENNA IS GOING TO BE EXPLOITING THAT ARM AS MUCH AS SHE CAN! THAT IS THE SMART THING ABOUT SIENNA JADE, SHE SEES HER TARGET AND DOES WHAT SHE CAN TO WEAR IT DOWN AS MUCH AS SHE CAN! SIENNA EXTENDS ASTRAEA JORDAN’S LEFT ARM OUT AND BEGINS TO STOMP ON IT! SIENNA PUTS ALL OF HER WEIGHT AND PRESSURE ON ASTRAEA’S ARM! ASTRAEA IS SCREAMING AS OUR OFFICIAL OF THE MATCH, MARTI SOLO LOOKS LIKE SHE IS GOING TO BEGIN HER COUNT!

Marti Solo: ONE! TWO! THREE! FOUR! FIVE!

Gavin Kirkland: Sienna Jade does not look like a happy camper as she gets all of her weight off of Astraea Jordan! Marti Solo pulls Sienna back as the two of them are having a few words with each other! Unfortunately, our microphones are not able to get what is being said! Meanwhile, you have Astraea, who is clutching to her left arm as she is slowly rising back to her feet! Astraea has a ton of fight in her and why wouldn’t she? This woman is driven and motivated! Despite the time that she waited to get this match, Astraea has managed to keep calm and wait! She has been patient on making sure that the other girls get their title shot, but this is Astraea’s time! No one is going to take it away from her, not even Sienna Jade! Sienna runs towards Astraea and connects with a dropkick! Astraea falls to her knees as Sienna stays on the offense! Sienna connects with a stiff kick to the back of Astraea! You can tell that Astraea felt that! I even felt that kick and I’m just sitting here! Sienna connects with another stiff kick to Astraea’s back before going in front of her and bounces from the ropes and connects with a low dropkick! Sienna quickly goes for the cover!

Marti Solo: OOOOOOOONE!!

CJ Hana: Madison Kaline pulls Sienna Jade by her hair and throws her aside! Madison gets Astraea Jordan and throws her through the middle rope as Astraea falls onto ringside! The fans are booing due to the fan favorite of the match being taken out of the equation for the time being! Sienna goes right after Madison Kaline with a clothesline, but Madison does a matrix like move and bends backwards! Sienna stumbles past Madison, who gets Sienna and connects with straitjacket neckbreaker on the former Freeweight and Empire Tag Team Champion! Sienna clutches her neck in reaction to the move as Madison gets back to her feet! Madison is sticking her tongue out as she is skipping around Sienna! MADISON GOES AND GETS SIENNA BY HER FACE, BUT SIENNA JADE WITH A HUGE SLAP ACROSS MADISON’S CHEEK! MADISON IS CHUCKLING AS SIENNA IS WONDERING WHAT IN THE WORLD IS WRONG WITH THIS WOMAN? MADISON GETS SIENNA BY HER HAIR AND SMACKS HER BACK AGAINST THE MAT! MADISON GETS ON TOP OF SIENNA BEFORE CONNECTING WITH SOME RAPID SHOTS TO SIENNA’S FACE! SIENNA IS TRYING TO BLOCK EACH OF THOSE SHOTS, BUT IT IS NO USE! MADISON GETS SIENNA BY HER HAIR AND GETS HER UP TO HER FEET! MADISON GETS SIENNA IN POSITION BEFORE CONNECTING WITH A SNAP SUPLEX! MADISON STILL MAINTAINS SOME HOLD ON SIENNA BEFORE CONNECTING WITH ANOTHER SUPLEX ON SIENNA! MADISON IS SMIRKING AS IT SEEMS LIKE THE WOMEN’S WORLD CHAMPION IS JUST DOING THE SUPLEXES TO BRAG! MADISON GETS SIENNA AND FOR A THIRD TIME, CONNECTS WITH A SUPLEX! MADISON TRIES TO STAY ON THE OFFENSE AS SHE GETS SIENNA BY HER RIGHT ARM BEFORE WHIPPING HER TO THE ROPES! SIENNA COLLIDES HARD WITH THOSE ROPES AS MADISON CONNECTS WITH A HESITATION DROPKICK THAT THROWS SIENNA OUT OF THE RING FOR THE TIME BEING!

Gavin Kirkland: ASTRAEA JORDAN NAILS MADISON KALINE WITH A CLOTHESLINE! NO! MADISON DUCKS THE CLOTHESLINE AND CONNECTS WITH A BACK ELBOW! MADISON FOLLOWS THAT UP WITH A BACK KICK AS ASTRAEA CLUTCHES HER STOMACH IN PAIN! MADISON CONNECTS WITH A HIP TOSS! MADISON HAS A HEADLOCK APPLIED ON ASTRAEA! WHAT AMAZING STRENGTH FROM OUR WOMEN’S WORLD CHAMPION! I THINK PEOPLE MAY BE WRONG WHEN THEY SAY THAT ASTRAEA IS THE STRONGEST FEMALE IN THE MATCH! I THINK THAT MADISON COULD GIVE ASTRAEA A RUN FOR HER MONEY! DO NOT @ ME! Astraea is looking for some way to get out of the headlock! Astraea is trying to roll herself to her knees as she is successful in doing so! Madison still has that headlock applied as Astraea is trying to push Madison Kaline to the side and release whatever hold “The Mistress of Death” has on the Empress of Elite! Astraea Jordan manages to push Madison to the side! Astraea is free from Madison’s hold! Madison thinks quickly on her feet and connects with a superkick on Astraea! Astraea goes stumbling back, but she does not fall back! Madison connects with another superkick! Astraea stumbles back, but does not fall! The third time’s the charm as Madison connects with another superkick on Astraea! Madison quickly goes for the cover!

Marti Solo: OOOOOOOOONE!! TWO—

CJ Hana: Astraea Jordan kicks out at the start of the second count! Astraea is not going to be easy to get down for the three count! Astraea is as tough as they come! It is difficult to keep someone as determined as Astraea! Madison Kaline rolls her eyes as she seemed annoyed with the official’s count! These are not the officials that Madison is used too! She is used to the officials showing favoritism towards her! Madison gets Astraea by her hair! Madison is dragging Astraea by her hair as she takes her to the ropes! What in the hell is Madison doing? It seems like she is tying up Astraea’s long hair to the top rope! Astraea is trying to untie her hair, but Madison takes a few steps back! What in the world is she thinking of now! Madison runs! Crossbody on Astraea Jordan! No! Astraea manages to lift Madison Kaline to the outside apron! Madison connects with a double rope stunner! Astraea Jordan goes bouncing up! However, her hair drags her down! Astraea is yelping in pain as she trying to untie her hair from the ropes! Our official even seems to be assisting Astraea with that! Meanwhile, Madison Kaline turns her attention towards Sienna Jade, who was recovering and strategizing her next move! Sienna uses her foot and pushes Madison to her knee! SIENNA GETS MADISON BY RIGHT ARM AND RAMS HER HEAD FIRST AGAINST THE BARRICADE! MADISON IS HOLDING HER HEAD AS SHE SIENNA RISES TO HER FEET! IT SEEMS LIKE SIENNA WAS ONE STEP AHEAD OF MADISON! SHE IS NOW TOUCHING THE SIDE OF HER HEAD WITH HER FINGER. THIS IS ALMOST LIKE SHE IS MOCKING THE WOMEN’S WORLD CHAMPION! SIENNA GETS MADISON BY HER RIGHT ARM BEFORE WHIPPING HER AGAINST THE STEEL STEPS! MADISON GOES CRASHING! HER ENTIRE BODY COLLIDED WITH THOSE STEPS HARSHLY! SIENNA GETS MADISON BEFORE THROWING HER ASIDE! WHAT’S ON SIENNA’S MIND AT THIS MOMENT?

Gavin Kirkland: Impact?

CJ Hana: Gavin, stop! Sienna Jade is separating the steel steps from the ring post! Sienna is positioning those steel steps a few inches away from the apron! Sienna measures the distance before getting Madison! Sienna hits Madison’s head with the ring apron before getting on the apron! Sienna drags Madison on the aprons as well! Sienna gets Madison in position for the back-to-back backbreaker! No! Madison tries to fight back with an elbow to Sienna’s face, who stumbles to the side! Sienna connects with a forearm before following that up with a knee! Sienna manages to get Madison Kaline in position for the Clapback, the Gory special!

Gavin Kirkland: JESUS CHRIST! SIENNA JADE WITH A CLAPBACK! MADISON KALINE COLLIDES BODY FIRST ON THOSE STEEL STEPS! THE CROWD IN THE FNB STADIUM SEEMED TO HAVE CRINGED A LITTLE! MADISON KALINE ROLLS ONTO HER BACK AS SHE IS CLUTCHING HER STOMACH IN PAIN!

???: GET THE F—CK OUT OF THE WAY!

(The crowd is heard roaring out of their seats at the sight of Astraea Jordan, hair all messed up, but more fiery than ever. Astraea is standing on the top turnbuckle as she is in position for another impressive move.)

CJ Hana: SIENNA JADE DOES THE SMART THING AND STEPS ASIDE! MADISON KALINE IS DOWN AND NOT MOVING AT ALL! ASTRAEA JORDAN FROM THE TOP TURNBUCKLE! AIR JORDAN! THE 450 SPLASH ON THE WOMEN’S WORLD CHAMPION! ASTRAEA LANDS ON MADISON! MADISON HAD HER KNEES UP! ASTRAEA IS CLUTCHING HER STOMACH IN PAIN AS SHE GETS OFF MADISON! SIENNA JADE IS LOOKING AT ASTRAEA’S RISK FAILING AND HAS HER JAW DROPPED! PERSONALLY, I DON’T THINK SIENNA SAW THAT COMING AT ALL! SIENNA RACES TOWARDS ASTRAEA AND GETS HER IN POSITION FOR THE CLAPBACK! NO! ASTRAEA CONNECTS WITH AN ELBOW TO THE BACK OF SIENNA JADE’S HEAD! SIENNA GOES STUMBLING BACK! ASTRAEA WITH A GERMAN SUPLEX ON SIENNA! NO! SIENNA MANAGES TO LAND ON HER FEET! SIENNA CONNECTS WITH A KICK TO THE STOMACH BEFORE GETTING ASTRAEA IN POSITION FOR A CLAPBACK! THIS TIME ASTRAEA LANDS ON MADISON KALINE WITH NO PROBLEM AT ALL! SIENNA JADE IS SHOWING SOME STRENGTH HERSELF AS SHE GETS ASTRAEA AND THROWS HER TO THE SIDE! SHE GETS MADISON KALINE AND DRAGS HER BY HER HAIR! SIENNA IS LOOKING LIKE SHE IS DRAGGING A RAG DOLL BY HER ROOTS! MADISON HAS NOT MOVED EVER SINCE SIENNA CONNECTED WITH THAT CLAPBACK! SIENNA GETS MADISON AND ROLLS HER BACK INTO THE RING! SIENNA GETS INSIDE THE RING AFTERWARDS! SIENNA GETS MADISON IN POSITION FOR THE RDG! THE BRIDGING FISHERMAN SUPLEX!

Gavin Kirkland: Our lord and savior, Madison Kaline is punching out of the position Sienna Jade has her for the RDG! Madison knows that if Sienna is able to hit this move, it’s all over for her! Madison is going to do her best to make sure that her title reign does not come to an end! Madison pushes Sienna out of the way! Sienna stumbles back and goes for a dropkick, but Madison gets Sienna by her legs! Madison swings Sienna to the side! MADISON GRABS SIENNA BY HER FACE AS SHE THROWS HER TO THE CORNER! MADISON CONNECTS WITH A FEW TURNBUCKLE THRUST BEFORE TAKING SIENNA TO THE TOP TURNBUCKLE AND MAKE SURE THAT SHE SITS THERE! SOON AFTER, MADISON STEPS ON THE SECOND ROW OF ROPES AS IT SEEMS LIKE MADISON KALINE IS GOING TO GO FOR A SUPERPLEX ON SIENNA JADE! THE WOMEN’S WORLD CHAMPION WITH A SUPERPLEX! BOTH OF THESE WOMEN GO CRASHING DOWN! MADISON TRIES TO ROLL OVER AND GO FOR THE COVER ON SIENNA!

Marti Solo OOOOOOOOONE!! TWOOOOOOOOOO!!

CJ Hana: ASTRAEA JORDAN BREAKS UP THE PIN! ASTRAEA JORDAN IS STILL A FACTOR IN THIS MATCH! ASTRAEA PICKS UP MADISON KALINE! LOOK AT THE STRENGTH OF THE EMPRESS OF ELITE! WE SHOULD TAKE SOME OF OUR COMMENTS BACK BECAUSE ASTRAEA’S STRENGTH IS SOMETHING THAT CANNOT BE IGNORED! ASTRAEA WITH THE GORILLA PRESS AS SHE DROPS MADISON KALINE DOWN! MADISON ROLLS ONTO HER BACK AS ASTRAEA FOLLS THAT UP WITH A STANDING MOONSAULT! Astraea tries going for a pin there, but Madison rolls onto her stomach to avoid any cover attempt to be made! Astraea gets Madison and it seems like Astraea is going to go for the Thot Breaker! The foot-pressed-on-the-head Boston Crab is applied on Madison Kaline! This is not a position that Madison wants to be a part of! Madison is trying to reach for the bottom rope, but she may have no other choice, but tap out! Sienna Jade is still recovering near the bottom rope from the superplex that she took a little earlier in this match! Astraea Jordan is trying to keep that move going as she is pulling Madison back, but Madison is screaming out in pain! Madison is clawing towards the bottom rope! She needs to get to the bottom rope to break the hold! Madison is refusing to tap out! She is refusing to let this title reign end and prove to everyone who thinks she is not deserving to hold the Women’s World Championship wrong!

Gavin Kirkland: Madison Kaline grasps onto the bottom rope! Astraea Jordan needs to release the hold!

Marti Solo: ONE! TWO! THREE! FOUR! FIVE! LET GO, ASTRAEA!

Gavin Kirkland: Astraea Jordan releases the hold! Madison Kaline slides underneath the bottom rope as she now rests on the apron! Astraea gets on the top turnbuckle! Is this woman mad? She is going to put her body on the line again? We all saw how well that Air Jordan did earlier in this match! What makes her believe that whatever she is going to pull next is going to work out for her? Astraea sets herself up on that top turnbuckle! Madison Kaline is resting on the apron just in perfect position for Astraea as she flies —

CJ Hana: — THE POWER OF EQUALITY! THE ELEVATED DOUBLE FOOT STOMP FROM THE TOP TURNBUCKLE TO MADISON KALINE ON THE APRON! ASTRAEA JORDAN FALLS TO RINGSIDE AS SHE CANNOT BELIEVE THE IMPACT OF THE POWER OF EQUALITY! Astraea finds herself back on her feet as the crowd gets on their feet as well! This crowd is behind Astraea Jordan! Astraea is feeding off that energy as she sees that Madison is finding herself in a seated position! Astraea does not waste any time as she connects with a big boot! Madison falls back and bounces off the ropes before landing on the outside! Madison looks dead at the moment! Like I don’t understand how she can keep going in this match!

???: IT’S YOUR TURN TO GET OUT OF THE WAY!

(The crowd stands up again as they see Sienna Jade setting herself up for the top rope. Sienna is looking back as Astraea Jordan is trash talking to Sienna. It seems like Sienna is going for a high risk move in this match.)

Gavin Kirkland: STARSTUCK! SIENNA JADE FROM THE TOP TURNBUCKLE TO THE OUTSIDE! SIENNA MANAGES TO LAND ON ASTRAEA JORDAN AND MADISON KALINE! THESE THREE WOMEN HAVE PUSHED EACH OTHER TO THE EDGE! THESE THREE WOMEN HAVE PUT EVERYTHING ON THE LINE FOR THE SAKE OF BECOMING WOMEN’S WORLD CHAMPION! THE CROWD IS APPLAUDING SIENNA FOR THAT IMPRESSIVE MOVE, BUT I AM STILL BAFFLED THAT THESE WOMEN ARE STILL ABLE TO GO ON! THIS MATCH IS ANYONE’S TO WIN! AT THIS POINT, I HAVE NO CLUE WHO IS GOING TO WIN! THESE THREE WOMEN ARE ON THE GROUND AS SIENNA JADE IS THE FIRST ONE BACK TO HER FEET! SIENNA GETS MADISON AND ROLLS HER INSIDE THE RING! SIENNA GETS ASTRAEA JORDAN AND THROWS HER AGAINST THE STEEL STEPS! SIENNA IS NOT RISKING FOR ASTRAEA TO GET HERSELF INVOLVED AGAIN! SIENNA LOOKS BACK AT ASTRAEA BEFORE GETTING ON THE TOP TURNBUCKLE! SIENNA HAS HER SIGHTS ON MADISON KALINE, WHO IS ON HER KNEES! SIENNA FROM THE TOP ROPE! RAW SIENNA ON MADISON KALINE’S BACK AS SHE FALLS! SIENNA RACES FOR THE COVER! NEW CHAMPION! NEW CHAMPION!

Marti Solo: OOOOOOOOONE!! TWOOOOOOOOOOO!! THREEEEEEEEEE!!

CJ Hana: Madison Kaline has her foot on the bottom rope! What wonderful ring awareness from the Women’s World Champion as Marti Solo is informing Sienna Jade about Madison’s foot on the bottom rope! Sienna has a heartbroken look on her face! She wanted nothing more than for that to be a three count! Sienna begins clubbing away on Madison’s face! Sienna is throwing some rapid fire shots at the “Queen of Death”! Sienna needs to chill! She cannot let her emotions get the best out of her! She cannot get frustrated because that does no one justice! SIENNA GETS MADISON BY HER FACE AS SHE BRINGS MADISON BACK TO HER FEET! SIENNA GETS MADISON BY HER ARM BEFORE WHIPPING HER TO THE CORNER! MADISON LANDS AT THE CORNER HARSHLY, BUT SIENNA IS NOT WASTING ANY TIME AS SHE RUNS TOWARDS MADISON WITH SOME DOUBLE KNEES TO THE FACE OF MADISON! MADISON FALLS FORWARD AS SIENNA JADE FOLLOWS THAT UP WITH A NORTHERN LIGHTS SUPLEX WITH A BRIDGE! BEFORE MARTI SOLO CAN GET IN POSITION FOR THE COUNT, MADISON ROLLS TO HER SIDE! SIENNA HAS MADISON’S ARM! SIENNA WITH THE FUJIWARA ARMBAR! THE ARMBAR LOCKED ON THE WOMEN’S WORLD CHAMPION! MADISON IS SCRAMBLING FOR THE BOTTOM ROPE! SIENNA DOESN’T HAVE A GOOD ENOUGH HOLD ON MADISON AS SHE QUICKLY MAKES IT TO THE ROPES!

Marti Solo: ONE! TWO! THREE! FOUR! FIVE!

Gavin Kirkland: Sienna Jade releases the hold as she rolls her eyes! She can smell a Women’s World Championship reign for her on the horizon! Madison is clutching her right arm as it took the submission hold as she slides underneath the bottom rope to recover on the apron! Sienna is trying to get Madison back into the ring! But, Madison is not letting go of the bottom rope! Madison is trying to buy herself some time to recover and think about a plan! She is trying to use her energy carefully at this point in the match! The crowd’s reaction is getting louder, CJ! This crowd is getting a little antsy as Sienna Jade turns around!

CJ Hana: SPPEEEEEAAAAAAARRRRRRRR!! THE SPEAR FROM ASTRAEA JORDAN! SIENNA JADE GETS RIPPED IN HALF WITH THAT SPEAR! ASTRAEA RUNS TOWARDS MADISON AND KICKS HER OFF THE APRON! ASTRAEA GETS SIENNA TO HER FEET! ASTRAEA HAS SIENNA JADE IN POSITION FOR LATE REGISTRATION! THE SNAP POWERBOMB CUTTER! LATE REGISTRATION CONNECTS! ASTRAEA JORDAN GOES FOR THE COVER!

Marti Solo: OOOOOOOOOOONE!! TWOOOOOOOOOOO!! THREEEEEEEEEEEEE!!

Gavin Kirkland: MADISON KALINE BREAKS THE COVER! SHE IS NOT LETTING HER TITLE REIGN END! MADISON KALINE REFUSES TO WATCH SIENNA JADE OR ASTRAEA JORDAN TAKE THE CHAMPIONSHIP SHE WON BACK IN OCTOBER! MADISON KALINE GETS ASTRAEA JORDAN AND CONNECTS WITH A TORNADO DDT! NO! ASTRAEA MANAGES TO THROWS MADISON OFF POSITION FOR THAT TORNADO DDT! MADISON LANDS ON HER TWO FEET AS SHE TURNS HERSELF AROUND! ASTRAEA JORDAN WITH A FREE SMOKE! THE REVERSE ROUNDHOUSE KICK, BUT MADISON DUCKS OUT OF THE WAY! MADISON GETS ASTRAEA! M.O.D ON THE EMPRESS OF ELITE! ASTRAEA IS DOWN! MADISON SLOWLY RISES TO HER FEET WITH A HUGE GRIN ON HER FACE! IT SEEMS LIKE SHE IS PLANNING TO TAKE ASTRAEA JORDAN TO THE AFTERLIFE! SLOWLY, MADISON IS STALKING ASTRAEA, WHO IS SLOWLY RISING BACK TO HER FEET! MADISON RUNS! AFFFFFFTEEEEEERRRRRRRLIIIIIIIFFFFFFEEEEEEE—

CJ Hana: — No! Astraea Jordan ducks! Madison Kaline runs past Astraea and FREE SMOKE! Astraea drops Madison with the Free Smoke! The Free Smoke front out of nowhere! Madison is completely out of it! Why isn’t Astraea going for the cover as she is admiring the an out cold Women’s World Champion! Astraea Jordan picks up Madison Kaline! It seems like she is going to pay tribute to Diamond Cage with this move! CRADLE TO THE GRAVE! THE VERTICAL SUPLEX PILEDRIVER ON MADISON KALINE! ASTRAEA GOES FOR THE COVER!

Marti Solo: OOOOOOOOOOOOONE!!!! TWOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEEEEEEE!!!

….
….
….

Gavin Kirkland: Sienna Jade with a Starstruck on Astraea Jordan and Madison Kaline! Astraea was so close to winning the match! Madison is still out of it as Sienna quickly goes for the cover on Madison!

Marti Solo: OOOOOOOOONE!! TWOOOOOOO!! —

CJ Hana: Astraea Jordan pulls Sienna Jade by her hair, lifting her off of Madison Kaline before slamming her back! Astraea begins throwing some fists at Sienna’s way! Sienna has no way to defend herself as Astraea is getting each of these shots in! ASTRAEA GETS SIENNA TO HER FEET! ASTRAEA CONNECTS WITH A CHIRAQ FLOWSION! NO! SIENNA IS ABLE TO STOP HERSELF FROM THE MOVE CONNECTING COMPLETELY! SIENNA IS WOBBLY ON HER FEET AS SHE PULLS ASTRAEA JORDAN IN AND CONNECTS WITH A WITCHES HAMMER! THE RIPCORD ROLLING ELBOW ON ASTRAEA, BUT THAT DOESN’T KNOCK HER DOWN! SIENNA JADE GOES FOR ANOTHER WITCHES HAMMER AS ASTRAEA GETS KNOCKED TO HER KNEES! SIENNA GOES TO THE ROPES AND REBOUNDS OFF OF THEM BEFORE CONNECTING WITH FRONT DROPKICK! THE EMPRESS OF ELITE GOES DOWN AS SIENNA JADE DELIVERS A WARRIOR CRY! SIENNA GETS ASTRAEA JORDAN BACK TO HER FEET AS SHE LEADS HER TO THE TOP TURNBUCKLE! IT SEEMS LIKE SIENNA IS GETTING ASTRAEA IN POSITION FOR THE RDG! THE BRIDGING FISHERMAN’S SUPLEX! IF I CAN RECALL FROM WATCHING HER MATCHES, I THINK SIENNA DID THIS SPOT AT TERMINUS LAST YEAR! IT WOULD HAVE BEEN A THREE COUNT IF IT WASN’T FOR PAYTON DARKSTAR! SIENNA HAS ASTRAEA IN POSITION! RRRRRRRRRRRDDDDDDDDDDDDCDDGGGGGGGGGGGGGG!! THE RDG FROM THE TOP TURNBUCKLE! SIENNA JADE GOES FOR THE COVER!

Marti Solo: OOOOOOOOOOOOOONE!! TWOOOOOOOOOOOOOO!!

Gavin Kirkland: Madison Kaline slides to break up the count!

Marti Solo: THREEEEEEEEEEEEEE!!

CJ Hana: It was too late though! Sienna Jade wins!

(Ding! Ding! Ding!)

(“F.U.U.” begins to play through the speakers as the crowd in the FNB Stadium roars in a mixed reaction. Some people admiring and amazed by her performance and others still loathing the woman. Sienna Jade collapses to her knees as a huge wave of emotion rushes through her.)

Maria Del Rey: THE WINNER AND NEW ELITE ANSWERS WRESTLING WOMEN’S WORLD CHAMPION, SIEEEEEENNNNNNNNNNNAAAAAAAA JAAAAAADDDDDDDEEEEEEEE!!

CJ Hana: For the first time since REVOLT Pro Combat, Sienna Jade finds herself on top of the Women’s Division! Sienna has been through hell during her time on Empire. She had been waiting SEVEN months to get her rightful title opportunity! Despite being a former Empire Tag Team Champion, she had felt something was missing from her. She did not feel like herself and losing that Freeweight Championship felt like she lost a piece of herself, but tonight, Sienna Jade got the gold she believe she should have won at Pain for Pride and redeem herself from that loss!

Gavin Kirkland: The 2018 Female Elitist of the Year! She had admitted that she was feeling unmotivated and she hasn’t been delivering her best. She wanted this opportunity more than anyone in the back and the moment that Kendra Shamez gave her this match, she went all out for it! She was going to stop at nothing to make sure that this Women’s World Champion was her’s!

(Tears are pouring down Sienna Jade’s face as she gets herself on her feet! Marti Solo hands the Women’s World Championship to Sienna Jade, who looks at the title with wonder and amazement.)

Gavin Kirkland: Look, who’s coming to join the party!

(The crowd gets rowdy as Kassidy Heart and Tyler Wolfe appear on the top of the ramp applauding Sienna Jade. Kassidy and Tyler make their way to the ring! Sienna Jade is holding the Women’s World Championship up as Kassidy and Tyler step inside the ring! Jaded Wolfe Hearts embrace each other in the middle of the ring as Kassidy Heart gets the Women’s World Championship before buttoning up on Sienna’s waist.)

(Meanwhile outside the ring, Madison Kaline is on the middle of the ramp as she is looking back at Sienna Jade in the ring. Madison Kaline has a look of heartbreak and anger in her face. With Astraea Jordan, she has her back on the barricade as she has a state of shock and anger on her face, not being able to process what just happened.)

CJ Hana: Madison Kaline had an amazing run as Women’s World Champion! Not many people believed that she would be champion again, but she managed to surpass her first championship reign. She got victories over Stephanie Matsuda, Andrea Valentine and Raven Roberts! Astraea Jordan had been waiting for this match ever since August and to have it result in failure must be shocking to her! I don’t think any of these three women are going to be the same again!

Gavin Kirkland: I don’t mind Sienna Jade as Women’s World Champion! Hopefully, Stephon Hunte sends her some blonde hair dye because she could be FOX worthy for us!

CJ Hana: Amazing performances from these three women, but congratulations to Sienna Jade!

(“All I Do Is Win” by DJ Khaled ft. Ludacris, Rick Ross, T-Pain & Snoop Dogg blasts through the speaker, blending with the chaotic cheers roaring down the approaching first challenger for the EAW New Breed Championship, Crosby Carter. Crosby Carter walks down the ramp with his wife Carsyn Carter by his side. His theme song reeks of confidence, which is perfect for the Bro. This is his dream and he’s having the time of his life.)

Maria Del Rey: Ladies and gentlemen, the following is a fatal fourway match with the EAW New Breed Championship on the line! Introducing first! Accompanied by his love Carsyn Carter, from Woodbridge, New Jersey, weighing in at one- hundred and ninety-nine pounds.. HE IS THE EXPLOSIVE….. CROSSSSSSBYYYYYY CAAAAAARRRRTTTTERRR!!!!!

(Carsyn walks Crosby to a corner of the ring where they hug as the second challenger begins to embark his journey to the squared circle. The instrumental version of “Suicide Silence” by You Only Live Once hits and Damon Diesel makes his way towards the ring. With a confident stride shown in his posture and an arrogant smirk on his face, he has an opportunity to finally validate himself after failing to win the New Breed Championship previously. Damon enters the ring, smirking, as he eyes down the white trash version of Jey and Bey, before walking over to his respective corner )

Maria Del Rey: And his opponents! First, from Orlando, Florida, weighing in at two-hundred and fifteen pounds…. HE IS THE WRESTLING MACHINE….. DAAAAAMONNNNN DIEEESELLLLL.

(The serpentine love couple of Carsyn and Crosby Carter roll their eyes towards Damon Diesel, with Carsyn calling him a “failure”. As Carsyn begins to get louder, “Another One Bites The Dust” by Queen blares throughout the arena. Grey smoke covers the top of the stage as the reimagined version of The Visual Prophet steps onto the premises, sending shockwaves throughout the crowd as they cheer. )

Maria Del Rey: From Detroit, Michigan, weighing in at two-hundred and thirty pounds… HE IS THE ICON….. THE VISUAL PROPHET!!!!

(Visual Prophet blows a kiss towards Carsyn Carter as she restrains Crosby from assaulting him. He gets inside the ring and tells Carsyn to SMD.)

(The crowd prepares for the arrival of the champion next, anticipating in excitement as ‘‘Zombie” by The Pretty Reckless plays. The South African crowd greet Raven Roberts with a mixed reaction. They respect the hell out of her title reign, but let’s be real. She’s not the nicest person. Raven Roberts approaches the stage, beholding the large environment of the stadium, possibly making her last entrance as the EAW New Breed Championship. She deattaches the championship belt from her waist, lifting it up as fireworks fall from the rafters. She plants the championship belt onto her shoulders, walking down the ramp with a fearless demeanor. She truly is the New Breed Queen.)

(Raven makes her way into the ring, and all four competitors begin eyeing up one another. The referee takes the title from Raven, holds it up, and then calls for the bell.)

( DING! DING! DING! )

CJ Hana: It has been one hundred and thirty-three days since Raven Roberts ripped the EAW New Breed Championship from the hands of Xander Payne at Territorial Invasion. Since then, she has held the championship pridefully and dominantly. However, will this be the last day of her reign? Damon Diesel, Visual Prophet, and Crosby Carter have an opportunity to obtain their first championship in EAW at the expense of Raven Roberts.

Gavin Kirkland: Raven Roberts should be making me a meal right now, but instead she is defending her title. However, wrestlers are wrestlers, even though women are weak, they wrestle. The bell has rung as all competitors are in their respective corners, eyeing each other down. The motto of this event is an eye for an eye is never enough and there are reasons for that.

CJ Hana: All four individuals have kept their eyes on each other this entire week and all those verbal battles are about to culminate right in front of us. Visual Prophet now walking into the center of the ring as all individuals have yet to land a finger on each other. The hell is he doing?

Visual Prophet: ALL OF YOU……. SAY…… MY…… N-.

Gavin Kirkland: SUPERKICK!!!!! VIZ WAS JUST RUDELY INTERRUPTED BY CROSBY CARTER WITH A SUPERKICK AND HE IS OUT COLD!!!!! EVEN DISGUSTING DEATHMATCH WRASSLERS CAN SUPERKICK I GUESS!!!

CJ Hana: Raven and Damon are just standing witness to what just happened, frozen as Crosby Carter just knocked the Visual Prophet out as we are just getting started!

Gavin Kirkland: AND THE ACTION BEGINS AS CROSBY CHARGES INTO RAVEN!!! RAVEN WAS FOCUSED ON DAMON AND CROSBY TOOK ADVANTAGE OF THAT!!! Roberts now pulling herself out of the ring as Damon whips Crosby into the ropes! BANG BANG!!! NO!!!! Crosby dodges the signature knee strike by Damon and spins around! DISCUS LARIAT!! NO!!! DAMON BLOCKS THE CLOTHESLINE ATTEMPT!!!

CJ Hana: But CROSBY WITH A SPINNING JUMPING GAMENGIRI!!!!! Crosby with the cat-like agility, quickly recovering from that failed attempt and taking him out with a gamengiri strike. Crosby now sending Damon into the ropes with an Irish whip! COQUINA CLUTCH!!! DAMON HAS HIS ARMS WRAPPED AROUND THE NECK OF CROSBY!!

Gavin Kirkland: A NEW NEW BREED CHAMPION COULD BE CROWNED DUE TO SUBMISSION!!! CROSBY RELEASES HIMSELF OUT OF THE HOLD, JUMPING DOWN TO A SEATED POSITION!! RAVEN ROBERTS WITH A BIG BOOT, SENDING DAMON CRASHING DOWN ONTO RINGSIDE!!! CROSBY PULLS HER DOWN!!!

CJ Hana: FIGURE FOUR!!! CROSBY GOING FOR THE FIGURE FOUR LEGLOCK BUT RAVEN PUSHES HIM AWAY INTO THE ROPES WITH HER FOOT! Crosby rebounds off the ropes as Raven gets to her feet! Raven moves out of the way and Crosby handsprings into the ropes! HE SOARS INTO THE AIR!!!

Gavin Kirkland: RAVEN CATCHES HIM!!! AND ROLLS HIM INTO A CROSSFACE!!!! WHAT A COUNTER!! TURNING THE SPRINGBOARD BACK ELBOW INTO A CROSSFACE!!! Raven twisting at his head, pulling it back as Crosby digs his fingers into the mat, painfully pulling himself towards the rope!

CJ Hana: Damon Diesel now inserting himself into the squared circle. AND GRABS CROSBY’S LEFT FOOT!!! AND TWISTS IT!! ANKLE LOCK IS APPLIED ONTO CROSBY!!!! CROSBY IS NOW ENDURING A CROSSFACE FROM RAVEN ROBERTS AND NOW AN ANKLE LOCK FROM DAMON DIESEL!! This could be it! Crosby Carter is going to tap out! Imagine how embarrassing this would be!

Gavin Kirkland: Crosby is in a situation where it is nearly impossible to get out of it yourself. Raven Roberts and Damon Diesel continuing to make him suffer. He is seconds away from tapping out or passing out and those are his only two options.

CJ Hana: AND CARSYN CARTER NOW GRABBING THE FINGERTIPS OF CROSBY AND PULLING HIM TOWARDS THE ROPES!!! BUT VISUAL PROPHET WITH A STEEL CHAIR TO THE BACK OF HER HEAD!!! NOT TO HER BACK, BUT TO THE BACK OF HER HEAD!!!! OH MY GOD!!! CARSYN IS OUT!!!

Gavin Kirkland: Visual Prophet now picking Carsyn up and throws her into the ring! He slides into the squared circle and lifts her up! OH!!! INVERTED HURRICANRANA!!!! CARSYN JUST SPIKED VIZZY’S SKULL ONTO THE CANVAS WITH AN INVERTED HURRICANRANA OH MY GOD!!!

CJ Hana: HOW IN THE WORLD DID SHE DO THAT!!! Damon now confronting Carsyn, letting Crosby out of the ankle lock and SHOVES CARSYN AWAY!!! AND CARSYN JUMPS ONTO DAMON!!! AND SENDS HIM ONTO RAVEN ROBERTS!!! RELEASING CROSBY FROM ALL THAT PAIN!!!

Gavin Kirkland: Damon realizing what Carsyn had just done, smoke steaming out of his head as he looks towards her with a frustrated look on his face. AND CHARGES!!! OH!!! DAMON IS STOPPED IN HIS TRACKS AS CROSBY JUST THREW A STEEL CHAIR RIGHT INTO HIS FACE!!! OH MY GOD!!!!

CJ Hana: Carsyn and Crosby Carter together in the ring, what a display of true love! Raven Roberts now sliding into the ring as Carsyn and Crosby stomp a mudhole into her! The dangerous couple now taking advantage of the no disqualification rules and attacking the champion.

Gavin Kirkland: Crosby picks up Raven as Carsyn flips backwards into a headscissors! Raven pushes Carsyn off her shoulders! OH!!!! RAVEN WITH A SHATTERING KNEE STRIKE ACROSS THE JAW OF CROSBY!! CROSBY GOES STAGGERING INTO THE CORNER AS CARSYN JUMPS TOWARDS RAVEN!!! RAVEN CATCHES HER!!! CARSYN WAS GOING FOR A HURRICANRANA, BUT RAVEN CAUGHT HER! SHE THROWS CARSYN INTO CROSBY WITH A POWERBOMB!!!

CJ Hana: RAVEN WITH A POWERBOMB THAT TAKES THE COUPLE OUT OF THE MATCH TEMPORARILY!!! Raven turns around!! VISUAL PROPHET OFF THE TOP ROPE!! RAVEN CATCHES HIM!!! She lifts him up in a fireman’s carry! TKO!!! NO!!!! VISUAL LANDS ON HIS FEET AND TWISTS RAVEN AROUND!! TWISTING DDT!! NO!!!! RAVEN SHOVES HIM TOWARDS THE ROPES!!

Gavin Kirkland: FACELIFT!!!! BUT VIZZY HOLDS ONTO HER FOOT!!! Raven was going for the spinning heel kick but Vizzy caught her foot AND NOW TRANSITIONS IT INTO AN ANKLE LOCK!! ANKLE LOCK LOCKED IN!!!

CJ Hana: Raven still on her feet as her other foot is being twisted by The VIsual Prophet with an ankle lock. Raven pushes Vizzy away! FACE LIFT!!! THE SPINNING HEEL KICK CONNECTS!!! IT SENDS VIZZY OUT TO THE APRON AS DAMON ENTERS THE RING!! DAMON CHARGES INTO RAVEN!!! RAVEN DODGES DIESEL AND HE GOES FLYING INTO THE APRON!!!!

Gavin Kirkland: Damon Diesel has found him in a precarious position as he is standing on the same apron as Vizzy! Raven taking a quick break as VIZZY PICKS DAMON UP!!!! PROPHET DRIVER ONTO THE APRON!!!! OH MY GOD!!! VIZZY ROLLS OUT TO THE EDGE OF THE APRON, LANDING HIS FEET AT RINGSIDE AS CROSBY INSERTS HIMSELF INTO THE RING!!! HE DODGES RAVEN AND JUMPS BETWEEN THE ROPES!!! AND SOARS ONTO THE VISUAL PROPHET AND DAMON DIESEL WITH A SUICIDE DIVE!!!

CJ Hana: Crosby Carter going for a two-for-one special and succeeds in doing so. All three men are gathered closely together in a pack as they exchange strikes while Raven begins to climb up the turnbuckles. The crowd begins to buzz and Raven continues to ascend the turnbuckles!! TWISSSSSTTTTIINNNNNG MOOOOOONSSAULLLLT!!!! RAVEN WITH A SENSATIONAL RAVEN’S WINGS ONTO THE THREE MEN AT RINGSIDE!!!! WHAT A MOONSAULT!!

Gavin Kirkland: Raven Roberts with her signature moonsault that always does her good! That was the same moonsault that won her the New Breed Championship and she begins to roll Damon Diesel into the ring! Damon took the most damage from the moonsault and Raven realizes that. Raven being smart here and begins to climb up the turnbuckle as Damon hasn’t moved!!!

CJ Hana: TWISTING MOONSAULT!!! BUT VIZZY GRABBING RAVEN’S FOOT FROM RINGSIDE, STOPPING HER FROM DOING ANYTHING!!! Vizzy now stepping through the ropes and goes up the turnbuckles. Vizzy grabbing Raven’s arm but she refuses to detach herself from the turnbuckles! The Visual Prophet going for a Uranage slam from the top rope but Raven refuses to let go. Damon Diesel now slowly making his way to his feet as VIZZY FLIPS FORWARD!!! POWERBOMB!! NO!!! RAVEN FLIPS BACKWARDS!!! TWISTING MOONSAULT ONTO DAMON DIESEL!!! OH MY GOD!!! I DON’T THINK THAT HAS EVER BEEN DONE BEFORE!!!

Gavin Kirkland: The Visual Prophet flipped forward, trying to take Raven down with a sunset flip powerbomb but Raven flipped backwards, twisting and landing onto Damon Diesel. Vizzy seated in the corner, shocked at what has just witnessed as Raven stands on her own two feet, eying the Icon down.

CJ Hana: The prophet uses the ropes to get to his feet as Raven charges into him! CROSBY WITH A STEEL CHAIR TO THE FACE OF RAVEN!!! WHATEVER PLANS SHE HAD IN MIND HAS JUST BEEN SPOILED BY CROSBY CARTER!!! AND BLASTS THE STEEL CHAIR ONTO THE BACK OF RAVEN!!!

Gavin Kirkland: The Visual Prophet snuck out of the ring as Crosby is fixated on the New Breed champion! Crosby slides out of the ring and brings up the apron sheets, bringing out panes of glass!

CJ Hana: We are about to see blood being shed! Crosby slides them into the ring as he steps up onto the apron! He grabs one pane of glass and tilts it towards the corner! He tilts another one in the other corner and pulls Raven into the center of the ring! Crosby reaches down his pocket and brings out a sack! AND REVEALS THE INSIDES OF IT AS HE POURS OUT THUMBTACKS ONTO THE CENTER OF THE RING!! AND SPREADS IT AROUND WITH HIS FEET!!!

Gavin Kirkland: HE GRABS RAVEN!! HE HOOKS HIM UP!! HE PICKS HER UP!!! SPINNING PACKAGE PILEDRIVER!!! NO!!!! DAMON DIESEL PUSHES CROSBY AWAY FROM RAVEN!!!! RAVEN CHARGES INTO DIESEL!!! BANG BANG!!! RAVEN EATS A KNEE STRIKE FROM DAMON DIESEL AS SHE STRUGGLES TO GET ON HER FEET!!!

CJ Hana: COQUINA CLUTCH!!! DAMON HAS HIS NO BREATHE SUBMISSION HOLD APPLIED!!! HIS ARMS ARE WRAPPED AROUND THE NECK OF RAVEN ROBERTS!! CROSBY IS ON THE TOP ROPE!!! HE SOARS OFF!!!! DOUBLE FOOT STOP ONTO BOTH INDIVIDUALS!!! WHAT A UNIQUE WAY TO INTERRUPT THE COQUINA CLUTCH!!! Damon Diesel taking the most damage as he was impacted by the body weight of Raven Roberts following the foot stomp.

Gavin Kirkland: Crosby now using his feet to slide Damon Diesel out of the ring, kicking him out as he begins to pick up Raven Roberts. HE’S GOT HER IN A POWERBOMB POSITION!!!

Gavin Kirkland: LOW BLOW!!!!! VIZZY WENT BENEATH THE BELT, RINGING CROSBY’S BELLS!! Looks like the Carters aren’t going to have children any time soon as Vizzy crawls away from the agonized Carter with a smile on his face!

CJ Hana: Raven slowly rolls out of the ring while Vizzy now picking Carter up off the ground! HE PICKS HIM UP IN A FIREMAN’S CARRY!!!! HE RUNS TOWARDS THE GLASS PANE!!! BUT IS STOPPED BY CARSYN!! CARSYN CARTER IS YELLING AT THE VISUAL PROPHET TO STOP!!! SHE IS BEGGING!!!! THE VISUAL PROPHET STOPPED IN HIS TRACKS BY CARSYN CARTER!!!

Gavin Kirkland: Vizzy lets Crosby off his shoulders, walking towards Carsyn with a sadistic smile on his face!! AND VIZZY IS MET WITH A SLAP TO THE FACE!!! VIZZY CHARGES INTO CARSYN!!! AND BULLDOZES CARZYN INTO THE GLASS PANE!!! OH MY GOD!!!!

CJ Hana: VIZZY TURNS AROUND!!! LOW BLOW!!!! CROSBY WITH A LOW BLOW OF HIS OWN AS HE HOOKS HIM UP!!!! SPINNING PACKAGE PILEDRIVER!!!! NO!!!!! VIZZY SOMEHOW PICKS HIM UP!!!! ROLLING DEATH VALLEY DRIVER!!! THE PROPHET DRIVER CONNECTS AS HE QUICKLY CLIMBS UP THE TURNBUCKLES!!

Gavin Kirkland: HE iS PERCHED AT THE TOP!!!!! BOWWWW TOOOO THE HEARRRRTTTT!!!! TALLLLLLLLLLLLLONNNNNNNNNNNNNN!!!!!!! CLAYMORE KICK IN MIDAIR!!!!! RAVEN ROBERTS WITH A CLAYMORE KICK OUT OF NOWHERE!!!!!

CJ Hana: RAVEN TURNS AROUND!!! DAMON DIESEL WITH A MOUTHFUL OF BRASS KNUCKLES TO RAVEN ROBERTS!!! DAMON DIESEL NOW PICKING HER UP!!!! PAIN MACHINERY!!! DOUBLE UNDERHOOK PILEDRIVER CONNECTS!! COVER!!

ONE…
TWO….
THREE!!!!!

Gavin Kirkland: KICK OUT!!!!! SHE KICKED OUT!!!!! HOW IN THE WORLD DID RAVEN KICK OUT OF THAT!?!?!!? DAMON IS SHOCKED!!! DAMON DOESN’T KNOW WHAT TO DO!!!!

CJ Hana: THE CROWD ARE ON THEIR FEET FOR THIS EPIC MATCH OF EPIC PROPORTIONS!!! DAMON NOW SLIDING OUT OF THE RING, GRABBING STEEL STAIRS!!! HE SLIDES THEM INTO THE RING!!!

Gavin Kirkland: HE SETS THE STEEL STAIRS UP NEAR THE CLUELESS, DEFENSELESS RAVEN ROBERTS!!! Raven Roberts is in danger! What in the hell does Damon Diesel have in his mind now?!?! Damon Diesel picks her up and plants her onto the top of the steel stairs. Diesel grabs her arm and turns them around, hooking them and lifting her up! He has her in a vertebreaker position! Oh no… It can’t b…

CJ Hana: DIESEL STEPS OFF THE STEEL STAIRS!!! AND DRILLS HER NECK INTO THE EDGE OF THE STEEL STAIRS WITH AN VERTEBREAKER!!!! HOLY SHIT!!!!!! Raven Roberts’s championship reign could be over! Damon Diesel may have ended her reign and her career with that vertebreaker onto the hard, steel steps!

Gavin Kirkland: Finally! Damon Diesel should be going for the cover now! What the hell is he doing!?!?

CJ Hana: Damon Diesel isn’t going for the pin, he’s going for another play! He put Raven on the steel steps and is starting to ascend the turnbuckles. Damon Diesel going for a huge play and he never goes on the top rope! He never soars inside the ring! Whatever Damon has in mind could win him the EAW New Breed Championship. The championship that has eluded him for months after failed shot after shot.

Gavin Kirkland: CROSBY SWEEPS DAMON’S LEGS OUT FROM THE TURNBUCKLES!!! DAMON’S GOES CRASHING DOWN ONTO THE TURNBUCKLES AS CROSBY JOINS HIM AT THE TOP ROPE!! BOTH MEN PERCHED AT THE TOP!!

CJ Hana: CROSBY PICKS DAMON UP!!! JEEERRSSEEY DRIVER OF DEATH ONTO THE STEEL STEPS!!! SUPER DEATH VALLEY DRIVER ONTO THE STEEL STEPS AS CROSBY AND DAMON FEEL THE PAIN AFTER THE CRASH LANDING ON THE HARDENED STEEL!!!

Gavin Kirkland: CROSBY CAN’T GET THE COVER!!!! HE CAN’T PIN DAMON FOR THE WIN!!! VISUAL PROPHET IS NOW ON THE TOP ROPE!!! BOWWWW TO THE HEARTTTTTT!!!! THE ELBOW DROP ONTO CROSBY ONTO THE STEEL STEPS!!!! IT CONNECTS!!! COVER!!

ONE…
TWO…
THREE!!!!!

CJ Hana: …..

Gavin Kirkland: ……

Re: ….

Gavin Kirkland: AND RAVEN BREAKS UP THE COVER!!! RAVEN ROBERTS IS STILL IN THIS MATCH!!!! Raven Roberts with the heart, soul, and resilience of a champion! Raven has defended that title for months and she will not give up now!

Cj Hana: The Visual Prophet’s jaw has dropped as a barely conscious Raven Roberts is still in this fight. Vizzy now with a smile on his face, a smile brighter than a kid getting her present on Christmas. He grabs the championship near the ring bell and slides it into the ring! He gets into the squared circle and yells at Raven to get up! Championship in his hand! AND SMASHES IT ACROSS THE FACE OF THE HELPLESS NEW BREED CHAMPION!!!!

Gavin Kirkland: RAVEN ROBERTS’ REIGN IS OVER!!! TAKE A LOOK AT YOUR NEW BREED CHAMPION NOW BECAUSE YOU ARE LOOKING AT THE NEW CHAMP, THE VISUAL PROPHET!! HE TOLD YOU HE WILL WIN IT AND NOW HE IS ABOUT TO BACK IT UP!

CJ Hana: Visual Prophet now propping the championship belt on the floor, planting a kiss on the “Raven Roberts” nameplate and lifts Raven into an STO… AND KISSES HER HEAD!!! TWISTING DDT ONTO THE CHAMPIONSHIP BELT!!!! HE CRAWLS OVER FOR THE COVER!!

ONE….
TWO….
THREE!!!!!

Cj Hana: RAVEN GETS HER SHOULDER UP!!!! RAVEN ROBERTS REFUSES TO LET HER REIGN END!!!! Visual Prophet was unable to put the rebellious champ away! He is unable to end her dominant championship reign!

Gavin Kirkland: Viz picks Raven up! BUT DAMON WITH A STEEL CHAIR TO THE BACK OF VIZ!!!!! DAMON PICKS RAVEN ROBERTS UP!!! AND THROWS HER INTO THE GLASS PANE!!!! RAVEN IS OUT!!!!

CJ Hana: Damon Diesel just took care of Raven Roberts and Visual Prophet is dead weight! Damon Diesel hooks both arms!!! PAIN MACHINERY!??!?!? NO!!!!! VIZ LIFTS HIM UP!!! PROPHET DRIVER!!!! ROLLING DEATH VALLEY DRIVER AS VIZ ROLLS UP ONTO HIS FEET AND STEPS UP ONTO THE TURNBUCKLE!!!!! HE’S UP AT THE TOP!!!

Gavin Kirkland: HERE IT IS!! BOW TO THE HEART!! DIVING ELBOW DROP ONTO THE HEART OF DAMON DIESEL!!! WE HAVE A NEW CHAMPION!!! VIZ SLOWLY GOES OVER FOR THE COVER!!!

ONE….
TWO…
THREE!!!!

( DING! DING! DING! )

( ‘Another One Bites The Dust’ by Queen hits to an emphatic burst of shouts of joy and awe as The Visual Prophet’s face lights up with a vibrant smile. He slowly makes his way up to his feet, using the ropes as leverage as he is handed the EAW New Breed Championship. He holds the championship with his hands, looking down at it as he smiles in prosperity. )

Maria Del Rey: LADIES AND GENTLEMEN…. HERE IS YOUR WINNER.. AND THE NEWWWWWW NEW BREED CHAMPION…… THEEEEE VISSSUAALL PROPHET!!!

Gavin Kirkland: From Xander Payne… to Raven Roberts… and now The Visual Prophet…. Raven Roberts with a dominant championship reign, taking the championship title over the world and successfully defending it and now The Visual Prophet has been the first to stop the unstoppable.

CJ Hana: This man was once a man with transparent flaws on Battleground and now he has transformed. Tonight, that transformation has done him good and he walks out of the FNB Stadium as the New EAW New Breed Champion. We all have adjusted ourselves to Raven Roberts being the face of the New Breed division and now the new face of the next generation have been crowned and that is the sovereign, the icon, and the new EAW New Breed Champion, THE VISUAL PROPHET…

( The Visual Prophet slides down the ring as the defeated Crosby Carter, Damon Diesel, and former champion Raven Roberts look up to him in disappointment. He lifts the championship high in the air as he walks towards the back.)

( DING! DING! DING! )

Stephie Love: THE FOLLOWING CONTEST IS SCHEDULED FOR ONE FALL AND IS FOR THE EAW PURE CHAMPIONSHIP!!!

( “Blood//Water” By Grandson starts up over the stadium speakers. )

Stephie: Introducing first The Challenger, accompanied by DEVAN DUBIAN! From Salem Massachusetts, weighing in at 185 pounds, THE REAPER… BBBBBBOOOOOOWWWWIIIIEEE GGGGGRRRRRAAAAAAYYYYYY!!!!

( Bowie Gray saunters out through the curtain with a sinister look on his face as he is dressed to compete, and Devan Dubian trails closely behind him wearing ring gear and a “Take By Force” t-shirt. )

Stew: Whether you like this sick and demented soul, Bowie Gray is one one of Friday night Dynasty’s up and coming young prospects! And when you combine his budding talents with his propensity for wanting to inflict as much punishment as possible it can equal a bad night for his opponents!

Talib: And lets not forget when he goes into that mental state and the reaper side of his personality takes control, like I believe we saw last Friday with that big brawl they had. After watching that Ms. Extreme may want to worry more about the kind of long term damage and permanent injury than just simply being concerned about losing the pure championship!

Stew: Gray is a dangerous individual but Ms. Extreme isn’t gonna back down, and certainly won’t give into fear! She is a fighter! She’s been fighting all her life! She fought to make it here to this level! She fought to become the EAW Pure Champion! And she will fight tooth and nail to keep that title!

(Gray rolls into the ring under the bottom rope. As he sits in the center of the squared circle rocking back and forth, his music slowly fades out. )

( A brief moment of silence, aside from the crowd booing, passes before “Gangster” by New Years Day hits driving the crowd wild with excitement.)

Stephie: and his opponent, from Calabasas, California, weighing at 135 pounds, she is the EAW Pure Champion, THE RED QUEEN… MMMMMMMMMMIIIIIIIISSSSSSSSS EEEEEEEEEEEXXXZZZZTTTTTTTRRRRRRREEEEEEMMMMMMMEEEEE!!!

( Ms. Extreme enters the stage with the people firmly in her corner. She takes a moment to bask in the adoration of the crowd before holding up the Pure Championship belt and make her way down the ramp.)

Stew: When you think of pure talent there are few who compare with this young woman! She has done not just her family, but herself proud! She has earned her place amongst the very best Dynasty has to offer! She can do it all, and considering who she is in the ring with, she may just have to!

Talib: Oh for sure! We have seen time and again Gray’s uncanny ability to absorb punishment! We know that he can take the licking and keep on ticking! But in my opinion what will really set Bowie Gray on a rocket ship to the moon will be the tutelage of one Devan Dubian! Under his wing I believe we’ve seen real growth out of Bowie Gray and in my opinion it may be enough to be what helps him claim the Pure title.

Stew: Speaking of whom, You have to believe Ms. Extreme will be keeping an eye out over her own shoulder keeping a watch out for Dubian here! And when you are keeping an eye out to watch your own back you’re obviously not entirely focused on your opponent! If that become the case in this you would have to wonder how that might affect this match?!

( Ms. Extreme enters the ring full of confidence and swagger. )

( DING! DING! DING! )

Stew: Devan Dubian steps through the ropes, to the apron and descends to ringside after bestowing undoubtable wisdom upon the young Bowie Gray, who is competing in his first FPV match in front of one of the biggest crowds of not only his career, but of EAW history! This is the largest viewing audience both live and from around the world in the history of King of Elite, and both of these Elitists are competing out of their element here in this PURE Championship match!

Talib: Ms. Extreme and Bowie Gray are closing in on each other almost looking like they’re about to have themselves a good ol’ fashion grapple! Could it be?! Is this real?!

Stew: BOWIE GRAY hits a disgustingly loud closed fist right to the midsection! He grabs Camille by the hair, and delivers a headbutt! That brings Extreme down to her knees, he hovers over her, and applies a neck crank trying to literally twist Ms. Extreme’s head right off of her own body!

Talib: Devan watching from ringside like a proud father watching his only son that made it. This may be a tightly sanctioned PURE Championship match but you can definitely get away with whatever inches you can find. Matches like these are a war of attrition Stew, you have to be able to endure more of the same conditions than your opponent, and personally I feel like one of these two psychotic human beings are just BOUND to snap!

Stew: Camille has made it back up to her feet, escaping the neck crank, and counters out of it with an Irish whip to the ropes, Bowie rebounds off the ropes and she doubles over for a back body drop! Bowie counters with a sunset flip rollup! Ms. Extreme rolls through the roll up and BLASTS HIM ACROSS THE FACE WITH A LOW DROPKICK! The two recover at a timely pace, Ms. Extreme rebounds off the ropes and fires back at Gray with a RUNNING LEAPING FOREARM RIGHT ACROSS THE FACE! Now she takes him right out of the corner with a bulldog! But Gray manages to slide to the mat mid-bulldog and somehow counter with a roll up! Hook of the tights!

Ref: OOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOOO!!!

Talib: The referee stops the pin! He caught a glimpse at Bowie’s hand hooking the tights, and that’s a no-no in PURE wrestling! Bowie Gray IMMEDIATELY gets in the face of the official, Devan Dubian also climbs up to the apron outraged by the ref’s decision, but this is a high pressure match for this official as every PURE Championship match is, and he is not going to budge on something like that! MS. EXTREME CATCHES BOWIE GRAY OFF GUARD WITH A CHOP BLOCK FROM BEHIND, POTENTIALLY CRUSHING THE TENDONS IN THE LEFT KNEE OF GRAY! Now Extreme steps in front of him and delivers a STEP-OFF ENZUIGIRI, BLASTING GRAY ACROSS THE HEAD AND LEANING BACK OVER HIM!

Ref: OOOOOOOOOOOOOOOOONE!!! TWOOOOOOO-

Stew: Gray with a shoulder up! Bowie Gray rolls out of the ring instinctively at the beckon call of Devan Dubian, and he’s at ringside limping before collapsing to his bottom and favoring his left leg. Ms. Extreme rolls out right after him and, to her credit, she is giving Bowie Gray zero quarter as she hoists Bowie up from the mat and SENDS HIM RIGHT DOWN TO THE RINGSIDE FLOOR WITH AN OLYMPIC SLAM!!! SHADES OF STARR STAN!!! THAT WAS AN IMPRESSIVE POWER MOVE FROM THE PURE CHAMPION, AND AND MS. EXTREME GIVES A SLY GRIN TO DEVAN DUBIAN AFTER HITTING THE MOVE OF HIS LONG-TENURED ENEMY, AND FORMER ALLY!

Ref: 1! 2! 3! 4!

Stew: Ms. Extreme drags Bowie Gray up from the floor again, and takes him by the nape of the neck to run across ringside with him and send him into the barricade! But Gray SHOVES Extreme away, she nearly hits the barricade, she turns around, and is BLASTED WITH A WILD LARIAT BY BOWIE GRAY! BUT EXTREME COUNTERS WITH A BOOT TO THE FACE! AND NOW SHE FOLLOWS UP… BLEEDING EDGE!!!! BLEEDING EDGE FROM MS. EXTREME TO BOWIE GRAY, WHILE SHE LOOKS DEVAN DUBIAN DEAD IN HIS EYES!!!

Talib: BUT BOWIE COUNTERS OUT OF IT, SHOVING EXTREME AWAY AT THE LAST SECOND AND SENDING HER BOUNCING HEAD FIRST OFF OF THE LED RINGPOST!!!

Ref: 8!! 9!!!! 10!!!

Stew: That could have just ended the match right there! Extreme collapses to the floor as the referee reaches a count of 10, and some of our not-so-bright fans in the FNB Stadium are cheering because they think the match is over, but sorry folks, PURE Title matches have a count up to 20! Bowie Gray pulls Ms. Extreme up from the floor after loosening a knot in his back, and HE TAKES HER RUNNING OVER TO THE RAMP JUST TO SEND HER UP AND OVER WITH A HIP TOSS! AND MS. EXTREME SMACKS RIGHT INTO THE CONCRETE FLOOR AT THE BOTTOM OF THE RAMP! Bowie Gray hobbles back to the apron and rolls back in the ring as the referee’s count nears closer to twenty… but at the chagrin of Devan Dubian, it looks like Bowie is actually breaking his own count!

Talib: Yeah Dub doesn’t like that, and HE’S REALLY NOT GOING TO LIKE THIS! BOWIE GRAY FLIPPING UP THE RING APRON, AND PULLS OUT A BARBED WIRE BASEBALL BAT!!!! WHAT THE HELL DOES HE THINK HE’S DOING?!

Stew: I TALKED TO DEVAN DUBIAN EARLIER, HE TOLD ME BOWIE GRAY HAS A RAGE BURNING INSIDE OF HIM THAT REMINDS HIM OF HIS OWN SELF, AND THAT HE’S THERE TO CONTROL THAT RAGE AND CHANNEL IT, BUT IT LOOKS LIKE BOWIE IS WORKING AGAINST THE TEACHINGS OF DEVAN DUBIAN!

Talib: Bowie approaching Ms. Extreme with a look that would kill, and Devan himself has to intervene in order to remind Bowie about the implications of this match! Bowie Gray is just SECONDS away from blasting Ms. Extreme over the head with that barbed wire bat, as she’s using the rampside barrier to recover, but ultimately he adheres to the words of his coach and tosses the bat to the side! NOW BOWIE GRAY UNLOADS WITH HEADBUTTS, DELIVERING THREE OR FOUR HEADBUTTS IN TANDEM FOLLOWED BY ANOTHER RIB-CRUSHING SHOT! AND NOW A FLURRY OF STOMPS TO ANY OPEN PART OF THE BODY OF THE EAW PURE CHAMPION!

Stew: BOWIE GRAY RIPS MS. EXTREME UP FROM THE FLOOR, TAKES HER FROM THE BOTTOM OF THE RAMP AND OVER TO THE STEEL STEPS, AND SENDS HER CRASHING INTO THE STEPS WITH A COLLISION SO HARD SHE ENDS UP FLIPPING OVER THEM, COMPLETELY TURNED INSIDE OUT!!!

Talib: YEEZUS!!! That looked as deadly as it sounded! Bowie is like a tasmanian devil, there is little to no stopping him once he gets going, which is why he’s got one of the best records of any rookie Elitist coming into 2019! Bowie takes Extreme back into the ring and finally follows her back in, and Extreme is attempting to crawl across the ring to the other side to find an escape, but Bowie snatches Extreme by her boot and is playing tug of war in order to prevent her escape! NOW EXTREME ON ONE LEG FIRES OFF A BACK ELBOW! That creates separation, Extreme turns around, and BOWIE TURNS HER INSIDE OUT WITH A CLOTHESLINE FROM HELL!!! EXTREME RETURNS TO HER FEET SPAGHETTI LEGGED, STRICTLY OFF MOMENTUM, AND BOWIE HOOKS HER FROM BEHIND! JUMPING BODY-SCISSORS INVERTED DDT!!!! JESUS HE MIGHT HAVE JUST SNAPPED MS. EXTREME’S NECK WITH THAT ONE, DEVAN DUBIAN PUMPING HIS FIST LIKE HE WERE PETE CARROLL AT SUPER BOWL 49 AT THE SIGHT OF THAT ONE! AND THERE’S THE HOOK OF BOTH LEGS!!!

Ref: OOOOOOOOOOOOOOOONE!!! TWOOOOOOOOOOOOOOO!!!!

Stew: KICK OUT BY MS. EXTREME! Interesting choice of Super Bowl reference Bari because the Seahawks actually lost that year, Patriots WON that Super Bowl, just like they’re going to win again this year!

Talib: How much you wanna bet?! Bowie Gray in the ref’s face as if he made a no-call on a pass interference, and the official is warning him to cool down his antagonizing behavior! The LAST match you want to give the referee any shit in is a PURE Championship match, the rules are damn near as strict as an Australian Open match! You could get disqualified for causing a racket let alone breaking one!

Stew: OK Bari we get it you watch a lot of sports. Bowie Gray returns to Ms. Extreme and he is just blatantly dragging her by her locks of hair, prompting the official to intervene and urge him to knock that off! Gray momentarily relents, before dragging at the locks of Ms. Extreme again and this time STEPPING ON THEM WHILE DRAGGING HER UP BY HER ARMS, AGAIN USING A CHEAP TACTIC MUCH TO THE DISPLEASURE OF THE OFFICIAL! The ref gives him another warning, and Tennis references aside Bari you are absolutely right about one thing, the referee has NO interest in coddling anybody out there, you can only get away with so many cheap moves in a PURE title match! Gray delivers a fist drop to the head of Camille, and now he’s mounted over her looking to deliver a full fledged CAMEL CLUTCH! Bowie Gray is putting the PURE Champion through the ringer right now, rearing back on the head to put as much damage on the neck and spine as he can.

Talib: Ms. Extreme is using every fiber of her being in order to muster up enough strength to – at the very least – gather some form of leverage. Bowie Gray is letting up on the camel clutch a little bit however to deliver a few more elbows right into the side of the neck! Camille drops to the mat seemingly defenseless, and Bowie Gray just screams obscenities down at the PURE Champion, before showing off for the audience as he’s got her right where he wants her.

Stew: But Extreme manages to crawl out of the camel clutch position! Bowie turns around, and OH MY GOODNESS!!!! HOW IN THE HELL?!?! MS. EXTREME EXPLODES UP TO HER FEET CARRYING BOWIE ON HER SHOULDERS!!! ALABAMA SLAM!!!! DIRECTLY INTO THE CANVAS!!! MS. EXTREME JUST CAME OUT OF THE GATE WITH AN EXTRAORDINARY MOVE, SHADES OF HER SISTER, AND SHE COLLAPSES BACK TO THE CANVAS FOR A BREATHER!

Talib: Impressive move by Camille Jane Ava, as both Elitists begin their recovery. You can see Bowie Gray favoring the already damaged left knee, and the injury looks like it might have been aggravated somehow by that powerful move! Now that both Elitists are up, Ms. Extreme has Bowie in the corner and is firing off with ferocious rights and lefts, delivering body shots! A strong striking background from the EAW PURE Champion, who is currently lighting up her challenger! Now she takes Bowie out of the corner, trades places, and delivers a VERTICAL SUPLEX DIRECTLY INTO THE CORNER!!! BOWIE HITS THE CORNER HARD, AND MS. EXTREME SPRINGS OVER THE ROPES, CLIMBS UP THE TURNBUCKLE HUFFING AND PUFFING AND DEALING WITH THE DAMAGE SHE’S HAD TO ENDURE THUS FAR!!! BOWIE FAVORING HIS NECK, WITH A BUM LEFT KNEE AND VERY LITTLE AWARENESS TO WHERE HE EVEN IS, BUT HE IS IN THE LINE OF SIGHT OF THE PURE CHA– DEVAN DUBIAN! DEVAN IS UP ON THE APRON! HE GRABS MS. EXTREME BY THE LEG!

Stew: MS. EXTREME WITH A KICK TO THE FACE TO SEND DUB OFF THE APRON! BUT BOWIE GRAY JOGS OVER TO THE CORNER AND POUNCES UP TO THE TOP TURNBUCKLE!!! LUCHA ARM DRAG FROM THE TOP ROPE!!!!!

Talib: MS. EXTREME LANDS ON HER FEET!!! BOWIE HITS THE FLOOR AND DELIVERS NOTHING, HE RECOVERS, AND MS. EXTREME DELIVERS A SPRINGBOARD ARMDRAG TO WHIP BOWIE GRAY ACROSS THE RING! HE HITS THE MAT WITH A HARD WHIPLASH, RECOVERS OFF OF MOMENTUM, AND MS. EXTREME FROM THE APRON DELIVERS A SPRINGBOARD DRAGONRANA!!! THAT SENDS BOWIE GRAY FLYING THROUGH THE ROPES DOWN TO RINGSIDE AND CRASHING INTO THE RINGSIDE FLOOR! BUT THE PURE CHAMPION IS FAR FROM FINISHED!

Stew: MS. EXTREME RUNNING THE ROPES AT THE ONSET OF BOWIE GRAY’S RETURN TO A VERTICAL BASE, AND SHE SPRINTS THROUGH THE ROPES!!!! SUICIDE DIVE!!!!!!!!! WIPING HIM OUT!!!!!

Talib: NOBODY HOME! DEVAN DUBIAN DRAGS BOWIE GRAY OUT OF THE WAY, AND MS. EXTREME SMACKS FACE FIRST INTO THE BARRICADE!!!! YIKES YIKES AND YIKES!!! The PURE Champion just hit the barricade like a speeding bullet, but she sure as hell didn’t hit her mark Stew, that was an atrocious collision!

Stew: Ms. Extreme hit the barricade with so much velocity that the fans right in front of her look like THEY dodged a bullet! Bowie Gray is trying to gather feeling back into his knee, and he limps over to the out-of-it PURE Champion and is desperately dragging her up from the floor in order to roll her dead weight back into the ring. The referee’s count is already at “7”, but Gray intends to finish this thing off in the ring now as he slides back in with her before going right for her legs… LOOKING FOR THE MOMENT OF SILENCE!!!!!!!!! MS. EXTREME INSTINCTIVELY JUMPS FOR THE BOTTOM ROPES, WRAPPING AN ARM AROUND THE ROPE AS QUICKLY AS SHE CAN, WHILE BOWIE GRAY APPLIES THE REGAL STRETCH!!! THE OFFICIAL DEMANDING FOR BOWIE TO RELEASE THE MOMENT OF SILENCE, BUT HE REFUSES! HE’S DUMPING OUT HIS RESERVES INTO THIS LAST GASP HOLD, AND THE OFFICIAL HAS HAD IT WITH BOWIE GRAY!

Ref: LET GO OF THE HOLD NOW DAMN IT!!!ONE!!! TWOOOO!!! THREEEEEEEEEEE!!! FOUUUUUUUUUR!!! FIIIIIIII-

( Bowie Gray lets out a manic scream, and releases the hold. He begins talking to himself, almost as if it were two people in his head talking to each other, which startles the official. )

Talib: BOWIE GRAY IS HAVING SOME SORT OF PSYCHOTIC FIT! HE IS HAVING A MENTAL BREAKDOWN, AND THE OFFICIAL LOOKS QUITE HONESTLY SCARED FOR HIS LIFE!

Stew: AND OFF THE DISTRACTED REFEREE, DEVAN DUBIAN HOOKS THE HEAD OF MS. EXTREME FROM RINGSIDE!!!! WHAT THE HELL!!!! WHAT THE HELL!!!! DRAPING DDT FROM THE APRON, PLANTING MS. EXTREME SKULL FIRST INTO THE RINGSIDE FLOOR!!! YOU’VE GOT TO BE KIDDING ME!!!

Talib: THAT WAS BRILLIANT STEW! DEVAN DUBIAN SCURRYING AWAY FROM THE SCENE OF THE CRIME! THE REFEREE DIDN’T SEE A DAMNED THING, AND MS. EXTREME IS DOWN FOR THE COUNT, DOWN AT RINGSIDE!

( Ms. Extreme tolds her head in agony at ringside, and Bowie Gray is up pacing back and forth. )

Stew: WHAT THE HELL IS WRONG WITH BOWIE GRAY?!

Bowie Gray: (to himself) No Reaper don’t do it! No Reaper don’t do it! No Reaper don’t do it! No Reaper don’t do it! No Reaper don’t do it! No Reaper don’t do it! No Reaper don’t do it!

( Bowie Gray continues the incantation with a faraway look in his eyes as he goes to ringside and picks up the barbed wire baseball bat, and makes his way back over to Ms. Extreme. )

Talib: BOWIE GRAY HAS COMPLETELY LOST ALL SELF AWARENESS! BOWIE WALKS OVER TO THE PURE CHAMPION WHO IS LAYING RIGHT IN FRONT OF US, COMPLETELY ZONED OUT! Devan Dubian approaches Bowie again demanding him to put the weapon down — BUT BOWIE SWINGS WILDLY AT HIS OWN MENTOR!!! DEVAN DODGES THE WEAPON SHOT AND RETREATS QUICKLY! AND NOW HE FOLLOWS MS. EXTREME INTO THE RING…. THE OFFICIAL WARNING BOWIE GRAY NOT TO GO ANY FURTHER……… AND BOWIE GRAY SWINGS THE BARBED WIRE BASEBALL BAT OVER THE SPINE OF MS. EXTREME!!! THIS MATCH IS OVER!!!

( DING! DING! DING! )

( Bowie Gray stomps around the ring snarling like an animal with a crazed, bloodshot gaze. )

Stew: BOWIE GRAY HAS JUST THROWN AWAY THIS MATCH! AND SO FAR HE IS BEYOND REPROACH! HE GOES BACK OVER TO MS. EXTREME AND BRINGS DOWN THAT BARBED WIRE BAT OVER THE BACK OF THE HEAD OF MS. EXTREME! EXECUTION STYLE!!!

( Ms. Extreme lays there completely unconscious. )

Talib: WH-WHAT THE HELL IS HE DOING?!

( Bowie Gray takes the barbed wire bat and drags it across his own forehead, ripping himself open as blood comes pouring down his face. Bowie smears blood on his own palm, watches it drip down from his hand to the floor, and lets out another manic yell. )

Stew: BOWIE GRAY WITH ANOTHER BARBED WIRE BAT SHOT INTO MS. EXTREME!!! AND ANOTHER!!! AND ANOTHER!!! HE’S GOING TO KILL THIS WOMAN!!!! HE’S NOT GOING TO STOP!!!

( A team of Dynasty referees and trainers swarm into the ring, led by Dynasty General Manager Starr Stan, and they completely surround Bowie Gray in order to pull him away from Ms. Extreme and pull the barbed wire bat out of his hands. )

Talib: Fam…. I have seen some sick ass dudes in my day, but this cat Bowie Gray is just BEYOND sick!

Stew: Even Devan Dubian is having trouble processing what he just saw. That was just an inexplicable act of violence, completely costing himself the PURE Championship. You almost want to assume he may have allowed the pressure of a big match situation to get to him, but look at his eyes, it’s almost as if they are completely void!

Talib: Maaan why Dynasty gotta have all the psycho muthafuckas :damn: Can’t we send some of them to Voltage or something?!

( Ms. Extreme is being tended to by officials, while Devan Dubian cautiously trails behind Bowie Gray who is being removed from the arena by Dynasty staff. )

( ‘Black History Month’ commercial featuring several top EAW Elitists of African American descent, reminding you to recognize black history every month, not just February. :mjpls: )

Maria Del Rey: The following contest is for the Empire Tag Titles and is set for one fall!

(A graphic of the Empire tag titles appears on screen.)

Maria Del Rey: Introducing first, the challengers, they are the former Empire Tag Team champions….The Crowe’s Nest!

(The lights go down, and the sound of “Glory and Gore” by Lorde fills the area. Red and white strobe lights flash as the beat kicks in. As the song builds up, Chelsea Crowe emerges with a spotlight focused on her. She gives the crowd a condescending look as another spotlight shines beside her and Jael is seen standing beside her.)

CJ Hana: Chelsea Crowe and Jael Rosario, the Crowe’s Nest, both have their game faces on. These two former champions are all business as they make their way to the ring. The Court will need to be on top of their game, or the Crowe’s Nest will become two time champions here tonight!

Gavin Kirkland: This match is great, if the Court win then the Love of my life, Cleopatra, might be in good enough mood to let me put a baby in her, but if not then the Crowe’s Nest might have a makeout session in the middle of the ring!

CJ Hana: You’re fucked, Gavin, you know that?

(Now in the ring, the Nest are in their corner discussing last minute match strategy.)

Maria Del Rey: Introducing their opponent, and the Empire Tag Team Champions…The Queen’s Court!

(‘Caterpillar’ by Royce da 5’9’ and Eminem plays as Amber Keys and Cleopatra walk out onto the stage. Cleopatra wears her title around her waist and is focused on the ring, and her opponents, while Amber holds her title high and runs her mouth to the crowd.)

Gavin Kirkland: CLEO, BABY! CJ, Look! She’s coming this way!

(Cleopatra walks past the announce table on her way to the corner of the Court.)

CJ Hana: Aw…no worries, Gav, I’m sure she’s just focused on the match is all. The Queen’s Court looking to make their second successful defense here tonight, one has to wonder is a powerbomb through a burning table isn’t in the future of either Jael or Chelsea? The Court are vicious, and cunning, a combination that makes them perhaps the most dangerous team on Empire!

Gavin Kirkland: Sexy, dangerous, and evil….the exact qualities I look for in a woman!

CJ Hana: Seriously mate, calm down!

(Maria exits the ring as the referee presents the titles to both teams before hoisting them high. She then hands the titles to Maria and calls for the bell to begin the match.)

(DING DING DING!)

CJ Hana: Empire Tag titles are now on the line! Looks like it’s Amber and Jael starting things off here tonight, and and they tie up! Amber slips behind Jael and catches her in a rear waist lock. Jael is trying to fight her way our, grabbing the wrists of Keys…Jael slips out! SHe holds onto the wrist, and whips Amber to the ropes…leaping knee strike from Jael! Amber is down, and backs quickly to her corner, tagging Cleopatra! The Queen of the Nile stares down Jael as she enters the ring and is met with a dropkick from Jael, but Cleopatra dodges, and quickly drops down to catch Jael in a headlock!

Gavin Kirkland: I wish Cleo would lock me in a headlock…Jael is using her long frame to work toward the ropes…rope break, and Cleo releases the hold! She quickly drags Jael back to the center of the ring by the leg, though, and drops an elbow onto the knee of the Original Sin! Wait! Is ‘lesbianism’ the original sin? I thought it was tax evasion?

CJ Hana: I think it refers to her pride, Gavin…regardless, Cleopatra pulls back on that knee, torquing it in a leg lock! Jael screams in pain, and is frantically searching for a way to break the hold, but can’t reach the ropes! Chelsea Crowe tries to enter the ring, but is stopped by the referee! Amber takes the opportunity to drop an elbow across the chest of Jael, breaking the hold, but flattening Jael into the mat! Keys slips out of the ring as the official turns her attention back to the match. Cleopatra pulls Jael to her feet and hooks her tights for a suplex, driving Jael back into the mat! Chelsea is trying to rally her partner, but right now Cleopatra is dominating this match! Off the ropes and the Queen of the Nile drops an elbow across the sternum of Jael, and hooks the leg!

Referee: ONE! TWO!

Gavin Kirkland: HOW DARE SHE KICK OUT!? I would have thought Jael would be used to a woman on top of her? Eh, now Cleopatra tags Amber who enters the ring and seems to be stalking Jael as she stands…Amber hits the ropes….JAEL COUNTERS WITH A BASEMENT DROPKICK! Jael pulled that move out in desperation, but it was effective! Amber is holding her knee in pain as Jael is reaching for the tag….she got it! Chelsea Crowe enters the ring! Crowe takes the injured leg and starts kicking the knee that Jael dropkicked! The Dirti Diva is trying to scramble to escape as Chelsea goes to town on that knee!

CJ Hana: The methodical nature of Chelsea Crowe slowly builds pressure during a match which often causes her opponents to break! She’s starting that pressure here tonight by trying to take the mobility away from Amber, who is the more agile of the two Court members. The referee finally makes the break as Amber reaches the ropes! Chelsea backs off as Amber pulls herself to her feet, making the Dirti Diva expend energy to stand, then approaches in a guarded stance. Limping, Amber swings at Chelsea, but her arm is caught and Crowe delivers an arm drag! Amber rolls through and meets Chelsea with a single leg dropkick that catches Chelsea in the mouth! Crowe drops to the mat as Amber stands and smacks her knee, trying to force it to work again. Hitting the ropes, she meets Chelsea with a spinning wheel kick, knocking the former Specialists Champion to the mat! Feeling confident, Amber drops an elbow across the back of Chelsea and then applies a rear chinlock, eliciting a scream in pain from Chelsea!

Gavin Kirkland: Jael breaks the hold with a kick to the back of Amber’s head, and immediately My Beloved, the Queen of my Heart, enters the ring in return and drives a forearm to the ample jaw of Jael! Catching the larger woman in a headlock, Jael stumbles back and through the ropes, both tumbling to the outside! The referee is demanding a restoration of order, though, and reprimands both, forcing them back to their corners! Meanwhile, back in the ring, CHelsea Crowe clips the knee of Amber Keys from behind as the Dirti Diva was yelling at the official, and has locked in a knee bar! The former World champion is struggling to reach the ropes and just makes it, causing Chelsea to drop the hold and drag Amber back to the Crowe’s Nest corner!

CJ Hana: Quick tag to Jael, and Chelsea props Amber up in the corner…Jael hits the far ropes as Chelsea holds Amber in the corner…RUNNING BIG BOOT TO AMBER KEYS! The Dirti Diva is knocked silly! SHe collapses to the mat and Jael hooks the leg!

Referee: ONE! TWO! THREEEEEEEEEEEEE –

CJ Hana: Cleopatra breaks the pin! That was close, but the Court is still in this! Cleo drags Amber to their corner and exits the ring before tagging the still disoriented Amber Keys. Jael meets Cleopatra with a quick kick to the gut and delivers a snapmare before hitting a quick dropkick to the back of Cleopatra. Jael then mounts Cleopatra and…wait, what’s funny?!

Gavin Kirkland: You said ‘Jael mounts Cleopatra’ I’ve had similar dreams….

CJ Hana: …Jael starts raining down elbows on the former Vixen’s champion, but Cleopatra is covering up expertly, and deflecting the blows. Seeing an opening, Cleo counters the position and grabs a handful of Jael’s hair before driving her forearm into the face of the Original Sin! Due to the hair pull, the referee calls or the break, and Cleo stands astride Jael…JUMPING STOMP TO THE STOMACH OF JAEL! Cleopatra flattened jael! Now…wait, she’s dragging Jael to the Crowe’s corner..? Cleopatra wants Chelsea! Crowe tags herself in, not taking her eyes off Cleopatra, who is pacing almost hungirly waiting for the former Specialists champion and leader of the Crowe’s Nest. The two circle each other, neither seeming to want to allow the other an opening…Cleopatra shoots in with a double leg, but Chelsea stuffs it, and secures a front face lock!

Gavin Kirkland: CLEO POWERS OUT! She stands out of the facelock, shrugging off that bull dyke Chelsea!

CJ Hana: Wait, I thought you liked Chelsea…?

Gavin Kirkland: I do, when she’s not trying to rub her lesbianism all over Cleo! She’s not going to convert the love of my life!!!

CJ Hana: That’s not…Chelsea doesn’t seem that fazed by the hold being broken, though, and locks in a collar and elbow tie up! Once locked in, Cleopatra falls back to her corner and makes the tag with Amber, who enters the ring and, along with Cleopatra, positions Chelsea…DOUBLE SUPLEX! Chelsea is planted with that and Amber now seems to be setting up Chelsea…SUPERKICK! NO! Chelsea catches the foot and delivers a nasty looking dragon screw! Amber screams out in agony, it looks like that was the same knee that had been worked over earlier in the match! The Dirti Diva tries to stand, but collapses, having to pull herself up with the ropes!

Gavin Kirkland: Amber is in a bad spot now, Chelsea is stalking Keys…running kick to the back of the knee! Amber, who was holding the ropes, almost flips completely over, She needs to get out of the ring or Chelsea is going to piece her apart! Pulling AMber back into the Crowe’s Nest corner, or as I like to call it, the Lesbian Lounge, before locking in a kneebar! As the referee is checking the Dirti Diva, Chelsea reaches for Jael…Chelsea, I can’t believe I’m saying this, ut now isn’t the time for lesbains!

CJ Hana: Gavin, you idiot, she’s grabbing Jael’s hands for leverage! Amber continues to cry out in pain as the Crowe’s Nest are double teaming her! What’s this? Cleopatra drops to the floor and walks around the ring…She pulls Jael down, breaking the hold! Amber scrambles away from Chelsea as The Black Heart diverts her attention to the outside of the ring! Chelsea leans through the ropes, grabbing Cleopatra by the hair, and pulling her off Jael who stumbles away! Cleopatra twists, and decks Chelsea right in the mouth, causing her to stumble back into –

Gavin Kirkland: AMBER ALERT! AMBER KEYS MANAGED TO HIT THE AMBER ALERT< BAD KNEE AND ALL! Chelsea is down and Amber collapses on top of her, making the pin!

Referee: ONE! TWO! THREE!

Gavin Kirkland: NO! Chelsea just manages to kick out! Amber just couldn’t deliver the Amber Alert with the authority she is used to, and it wasn’t enough to finish off Chelsea! In the meanwhile, the official has restored order and Cleopatra is back in her corner…CJ, look how she leans forward for that tag, nearly spilling out of her top….

CJ Hana: Jael reaches over the ropes and tags Chelsea, but I don’t think Amber or Cleopatra saw it! She pulls Chelsea to her feet and tags Cleopatra, the two lift Chelsea…DOUBLE POWERBOMB! Amber’s knee finally collapses and she rolls out of the ring as Cleopatra makes the pin only for the referee to tell her that Chelsea isn’t legal! Cleopatra s attacked from behind from Jael, who knocks the Queen of the Nile back into the Court’s corner! Jael rolls CHelsea out of the ring, before returning her focus on the former Vixen’s champion who is already back on her feet. The two meet in the center of the ring, Cleo grabs Jael’s wrist for a shortarm clothesline…NO! JAEL DUCKS! EVIL EYE! Jael hits the pumphandle brainbuster to the knee, and goes for the pin!

Referee: ONE! TWO!

CJ Hana: OUT OF NOWHERE AMBER BREAKS THE PIN! The Dirti Diva isn’t done yet! She manages to prop herself back up in the Corner, and reaches for the tag? Her knee is severely damaged, and she might want to reconsider that! Tag made, though, and Amber is in the ring now…She limps forward…UNANSWERED PRAYERS! Jael locks in the Koji Clutch! Amber is locked in the submission hold deep, and the referee…wait a minute! Cleopatra has the referee by the shirt, she’s keeping the official from checking on Amber…KEYS TAPS! She’s tapping out, btu the official didn’t see!

Gavin Kirkland: My Queen saves the day! Wait, what is Chelsea Crowe doing!? Cleopatra is pulled from the apron! The official returns her attention to the ring, but Jael has released the hold, thinking she had won! Stupid religious lesbian!

CJ Hana: Amber is in bad shape though, she’s pulling herself up with the ropes, but has paused, draping herself slightly over the middle rope, meanwhile on the outside of the ring…CHELSEA SMILE! The running knee drop flattens Cleopatra! Amber is trying to pull herself up, but LOOK OUT FOR JAEL! DIVINE ILLUSION! SHE HITS THE RUNNING KNEE STRIKE TO THE SIDE OF THE DIRTI DIVA’S HEAD! AMBER IS BOUNCED BACK INTO THE RING! JAEL MAKES THE PIN!

Referee: ONE! TWO! THREEEE!

Gavin Kirkland: NO! NO! NO!

(DING DING DING!)

Gavin Kirkland: NOOOOOOOOOOOOOO

CJ Hana: THE CROWE’S DONE IT!

(‘Glory and Gore’ begins playing as the official hands the Empire tag titles to Jael and Chelsea. The two embrace in the ring, holding the belts, as the scene fades elsewhere.)

(The King of Elite Throne is shown sitting on the stage.)

(Bella Braxton is shown standing in the ring.)

Bella: The following contest is a 4 way match scheduled for one fall and is for the…. 2019 KING OF ELITE CROWN!

(“The Devil In I” by Slipknot begins to play as Jason McKormick emerges to a mixed reaction from the crowd. He walks down the ramp and into the ring.)

Bella: Introducing first, form Jackson, Michigan, weighing 235 pounds… JASSOONNNN MCCKOORMICKKKKK!

James Peters: HERE WE GO! IT’S NOW TIME FOR THE 2019 KING OF ELITE MATCH! Jason McKormick shocked many by winning the Dynasty King of Elite portion of the tournament. He’s impressed so much so far, and he can do so even more here tonight.

(“A Story To Tell” by Woe, Is Me hits as the crowd begins to boo. Jack Ripley emerges on the stage as he ignores the crowd while going to the ring.)

Bella: From Las Vegas, Nevada, weighing 202 pounds…. JACKKKK RIPPLEEYYYYYY!

Rich Russillio: What a story it’s been for Jack Ripley! From struggling on Dynasty and being fired to coming to Voltage and earning a spot in the King of Elite finals. If he wins here tonight, things would have come full circle for him after all the struggles he’s had!

(“Pray For Em” by Meek Mill begins to play as the crowd continues to boo. Malcolm Jones then comes onto the stage with the Interwire Championship over his shoulder as he makes his way to the ring.)

Bella: From Harlem, New York, weighing 230 pounds… THE INTERWIRE CHAMPION…MALLCOLMM JONESSSSS!

James Peters: Malcolm Jones is coming from Showdown and seeks to add the crown to his Interwire Championship.

(“If I Had A Heart” by Fever Ray begins to play as the crowd cheers. Prince of Phenomenal then emerges onto the stage as he joins his opponents in the ring.)

Bella: Finally, from South Beach, Florida, weighing 220 pounds…. PRRINNCEEE OFFF PHENOMENALLLLL!

Rich Russillio: The Hall of Famer POP is the other representative from Voltage in this match. What a historic career he’s had. He’s done almost all that is to be done, and by adding the King of Elite crown to his accomplishments, he can further solidify his already amazing career.

(Ding! Ding! Ding!)

Peters: The 2019 King of Elite match is underway. We all know what’s on the line here and so do they. AND RIGHT OUT OF THE GATE GOES POP! HE QUICKLY GOES DIRECTLY FOR JACK RIPLEY WHO ASSAULTED HIM LAST WEEK ON VOLTAGE! POP HASN’T FORGOTTEN THAT AND NOW JACK RIPLEY IS A TARGET! POP jumps on him with a flurry of rights and lefts! He swings and swings as Jack desparately tries to defend himself! Jack pushes POP away and Jack tries to exit the ring… AND MALCOLM JONES STOPS HIM! HE GRABS JACK AND THROWS HIM RIGHT TOWARDS POP! Jack is stunned as to why Malcolm would do that and POP goes at him again!

Russillio: POP WITH A STRONG RIGHT JAB! JACK TRIES TO FIGHT BACK WITH A RIGHT SWING BUT POP BLOCKS IT! POP WITH A QUICK UPPER CUT…. PELE KICK! JACK GOES DOWN! POP standing tall over Jack Ripley… AND JASON MCKORMICK ENTERS THE FRAY! Jason comes at POP after he takes down Jack with a running forearm attempt… BUT POP SIDE STEPS IT! PELE KICK! POP WITH ANOTHER PELE KICK TO JASON MCKORMICK! AND ANOTHER PELE KICK! THIS TIME BY MALCOLM JONES ON POP! PELE KICK’S EVERY WHERE HERE IN THIS MATCH!

Peters: Malcolm Jones now quickly gets to work He picks up Jack Ripley and delivers a stern drop kick to the jaw that sends Jack tumbling out of the ring! He now lifts up Jason McKormick and places him against the ropes… CLOTHESLINE! HE CLOTHESLINES JASON OVER THE ROPES! POP IS NOW GETTING UP AND JONES COMES IN WITH A RUNNING SWINGING CLOTHESLINE! HE WANTED TO GET RID OF JASON AND JACK SO HE COULD TRY TO FINISH OFF POP! HE MAKES A QUICK COVER!

ONEEE! TWOOOOO!

Russillio: POP WITH A FIRM KICK OUT! Jones gets up as he takes a few steps to allow POP an opportunity to get up! Jones gets ready to charge POP… BUT JACK GRABS HIS FOOT FROM THE OUTSIDE! He jerks Malcolm out of the ring! Malcolm gets on his feet and throws a few right hooks at Jack! He now goes for an enzuigiri but Jack is quick to duck! DAYLIGHT SLAYING TIME! JACK RIPLEY DELIVERS THAT RUNNING KNEE TO THE HEAD TO MALCOLM JONES! HE CAPITALIZES ON THE MISSED ENZUIGIRI! NOW POP COMES RUNNING ACROSS THE RING WITH A BASEBALL SLIDE KICK TO JACK ON THE OUTSIDE THAT KNOCKS HIM DOWN!

Peters: POP gets to his feet but Jason makes his way inside the ring as POP remains unaware! HE CHARGES POP AND HITS A RUNNING FOREARM TO THE BACK OF POPS HEAD! POP falls forward but catches himself with the ropes! Jason comes from behind once more as he throws POP to the other side of the ring! POP bounces off the ropes… AND RUNS RIGHT INTO A DROP KICK FROM THE WAITING JASON MCKORMICK! Jason now climbs to the top rope as POP is still down from that drop kick! HE LEAPS FROM THE TOP ROPE AND LANDS WITH A DIVING ELBOW DROP RIGHT INTO THE HEART OF POP! NOW JACK RIPLEY SLIDES INTO THE RING AS JASON IS ABOUT TO GO FOR THE COVER! DAYLIGHT SLAYING TIME! HE HITS THAT KNEE RIGHT INTO THE SKULL OF JASON AND TOSSES HIM OUT OF THE RING!

Russillio: Jack now stands back as POP is getting up… YOU’LL FLOAT TOO! HE HITS THE SUPER KICK! JACK COVERS TO BECOME THE KING OF ELITE!

ONEEEEE! TWOOOOOOOOOOOOOOOOOOOOOOOOOO!

Russillio: POP KICKS OUT! JACK JUMPS UP IN ANGER! IN THIS KIND OF MATCH WITH FOUR PEOPLE, CHANCES TO WIN ARE FEW AND FAR BETWEEN! HE PICKS POP IN A SURGE OF ANGER! HE SHOVES HIM INTO THE CORNER WHERE HE DELIVERS SEVERAL AGGRESSIVE SHOULDER BLOCKS TO HIS MIDSECTION! Jack steps back and delivers a elbow right to POP’s jaw! He now lifts POP up onto the top rope! Jack climbs up there with him… BUT POP CATCHES HIM WITH A EUROPEAN UPPERCUT! Jack almost loses his balance as POP begins to stand… AND HE PUSHES JACK OFF! Jack falls off the top rope back down to the ring as he quickly tries to get to his feet. He turns back towards POP! POP NOW LEAPS WITH A MISSILE DROP KICK! IT CATCHES JACK RIPLEY!

Peters: POP pulls himself up as he takes this moment to recover. Jason McKormick now hops onto the apron and he grabs POP from behind! HE CATCHES HIM WITH A FOREARM! He now pulls POP onto the apron! He pulls POP in and brings him down for a big suplex! POP COMES DOWN BACK FIRST ONTO THE APRON! Jason now pulls POP down. Jason now grabs the steel steps from behind him and holds them up as POP gets up… AND HE RUNS TOWARDS HIM TO DRIVE THOSE STEPS RIGHT INTO HIS HEAD! POP GOES DOWN! Jason is the only one still up! Jack is down in the ring, POP is down here at ringside, and Malcolm… wait! Where’s Malcolm Jones?! Is that him over there in the bell keep area?!

(The camera turns to show Malcolm Jones sitting in a chair at ringside drinking a bottle of water as he watches the match from there.)

Russillio: When the hell did he take a seat over there?! Has he been sitting over there ever since he was knocked down while these other guys have been fighting it out? We must have been so focused on the match that he must have crawled over there after Jack hit him with the Daylight Slaying time.

(A replay is shown of Malcolm Jones taking a seat at about the same time as POP kicked out of Jack Ripley’s Superkick.)

Russillio: I can’t fault him for this strategy. These three guys are beating the crap out of each other and he’s just chilling over there staying hydrated. Jason doesn’t even notice him as he has his eyes directed on POP. Jason is still holding those steps as POP struggles to his feet… AND THIS TIME JASON LAUNCHES THOSE STEPS RIGHT INTO POP! THAT LUNGE HAD ENOUGH POWER BEHIND IT TO KNOCK POP BACK DOWN!

James Peters: Jason now grabs POP and he places his head on those steel steps. POP is motionless and Jason McKormick probably has something menacing in mind! HE COMES TO THE STEEL STEPS… DINNER TIME! CURB STOMP TO POP! NO! POP GETS UP AND DODGES! JASON TRIED TO DRIVE HIS HEAD INTO THOSE STEPS WITH A VICIOUS CURB STOMP! JASON NOW COMES AT POP AS HE GOES FOR THE SUPER KICK! ONE HE CALLS THE LEGACY! BUT POP SIDE STEPS IT! JASON REBOUNDS TO FACE HIM.. SCOOP SLAM! POP HITS A SCOOP SLAM AS JASON LANDS ON THOSE STEEL STEPS!

Russillio: POP has been right in the thick of things since this match started! He’s definitely feeling the effects as he struggles to get Jason McKormick up! He slides him onto the apron! He now pulls himself up there as well as he prepares to enter the ring… AND JACK RIPLEY JUMPS UP AND KNOCKS POP OFF THE APRON! HE LANDS ON HIS FEET AT THE OUTSIDE AND GRABS JACK TO PULL HIM OUT OF THE RING!

(While this is happening, Malcolm Jones is seen still sitting while talking to a fan who offers him a bag of popcorn.)

James Peters: POP GOES FOR A PELE KICK ON JACK RIPLEY! JACK DODGES IT AS HE QUICKLY MANEUVERS HIMSELF OUT OF THE WAY! JACK NOW GETS BEHIND JACK… DOUBLE KNEE BACK BREAKER! JACK NOW QUICKLY GRABS POP AND GETS ON THE STEEL STEPS! HE GRABS POP… OH MY GOD! RIPPLE EFFECT! THE VERTEBREAKER CONNECTS ONTO THE STEEL STEPS! POP HAS TO BE DONE FOR! A GRIN CROSSES THE FACE OF JACK RIPLEY AS HE NOW PULLS POP’S LIFELESS BODY OFF THOSE STEPS!

Russillio: Jack now pulls at POP and pushes him into the ring as he gets ready to enter it to… wait! Jack stops and slowly looks back where he just glanced as he was picked POP up! He looks bewildered as he stops and stares directly at Malcolm Jones! Malcolm has been over there drinking water, eating popcorn, and chatting with fans and Jack Ripley looks on in shock! Jack is just blankly staring at Malcolm as if just realizing that’s where he’s been since the beginning of this match.

(Malcolm notices Jack staring at him and begins looking around confused before pointing at himself and saying “Who, me?”)

James Peters: Jack now begins to approach Malcolm over in the bell keeper area where he’s sitting. He’s practically yelling at him. Malcolm just takes a drink of his water while this is happening… AND HE HITS JACK RIPLEY RIGHT IN THE HEAD WITH THAT WATER BOTTLE AS WATER GOES FLYING EVERYWHERE! He now hands one of the fans back their bag of popcorn that he ate some of. Jack falls back as that caught him off guard. Malcolm grabs Jack and leads him over to our announce table as he smashes his face into the table! Jack now elbows Malcolm in the gut as both men fight for control… LOOK IN THE RING! JASON MCKORMICK SEES THIS AND HE GOES TO COVER POP’S LIFELESS BODY! POP WAS JUST VICTIM OF JACK’S VERTEBREAKER ONTO THOSE STEEL STEPS AND JASON IS TAKING ADVANTAGE WHILE MALCOLM AND JACK ARE OCCUPIED WITH ONE ANOTHER! HE COVERS POP! NO WAY! JASON IS GOING TO STEAL THIS MATCH!

ONEEEEEE! TWOOOOOOOOOOOOO! THR—-

Russillio: KICK OUT! POP KICKS OUT AND THAT EVEN CAUGHT SOME OF US BY SURPRISE! I THOUGHT FOR SURE AFTER JACK HIT THAT MOVE, POP WOULD HAVE TO BE DONE FOR! BUT HE SURVIVES! Meanwhile, Jack uppercuts Malcolm and rolls him onto our table! Jack now stands on it as he pulls Malcolm up! He pulls in Jones and is setting up the Ripple Effect… BUT MALCOLM ESCAPES! ENZUIGIRI! HE HITS IT AND JACK IS OUT OF IT! MALCOLM CATCHES HIM BEFORE HE FALLS OFF THE TABLE! HE NOW PULLS JACK IN AND LIFTS HIM UP… FOR A POWERBOMB! HE THROWS JACK DOWN RIGHT ONTO THOSE STEEL STEPS FROM ON TOP OF OUR TABLE! WHAT A POWER BOMB BY MALCOLM JONES!

James Peters: Back in the ring, Jason is picking up POP… AND TAKES HIM OUT WITH A JUMPING KNEE SMASH! Malcolm now comes down off our table and grabs Jack… AND SENDS FLYING WITH A BELLY TO BELLY SUPLEX! NOW JASON COMES TO THE ROPES AND CLIMBS TO THE TOP… AND LEAPS AT MALCOLM! FLYING CLOTHESLINE ALMOST TAKES OFF MALCOLM’S HEAD! Malcolm gets up as Jason gets to his feet… MALCOLM MUSTERS HIS STRENGTH AND CHARGES FOR A SPEAR! THE C-NOTE! NO! JASON SIDE STEPS IT! JUMPING KNEE SMASH! HE CONNECTS WITH IT ONTO MALCOLM! HE NOW PULLS MALCOLM OVER TO THOSE STEEL STEPS AND PLACES HIS HEAD ON THEM! OH GOD! THERE HE GOES!

Russillio: DINNER TIME! CURB STOMP DRIVING THE SKULL OF MALCOLM JONES INTO THOSE STEEL STEPS! WHAT A VICIOUS DISPLAY BY JASON MCKORMICK! HE NOW PICKS UP JONES AND THROWS HIM INTO THE RING! Jason rolls back in! POP is beginning to stir at the ropes! POP is almost up… THE LEGACY! SUPER KICK RIGHT THE JAW OF POP! POP GOES OVER THE TOP ROPE AS JASON CONNECTS WITH THAT SUPER KICK! JASON NOW TURNS HIS ATTENTION BACK TOWARDS MALCOLM WHO MAY BE UNCONSCIOUS AFTER THAT CURB STOMP! Jason now slowly lifts up Malcolm.. not again! NOT AGAIN! DINNER TIME! HE DRIVES JONES SKULL BACK DOWN AGAIN FOR A SECOND CONSECUTIVE CURB STOMP! FIRST ONTO THE STEPS AND NOW IN THE RING! POP IS OUT OF IT! JACK IS OUT OF IT! JASON COVERS! I CAN’T BELIEVE IT!

ONEEEE! TWOOOOOOOOOOOO! THREEEEEEEEEEEEEEEEEE—

James Peters: KICK OUT! NO WAY! NO WAY! I CAN’T BELIEVE IT! MALCOLM JONES KICKS OUT OF TWO CONSECUTIVE CURB STOMPS! JASON MCKORMICK HAS JUST SEEN THE KING OF ELITE CROWN HANG RIGHT IN FRONT OF HIM BEFORE BEING PULLED AWAY! Jason stands up as a determination washes over his face. He takes a few steps back and I think he may be seeking another method of putting away Malcolm Jones. Jones is barely able to start moving as he slowly pulls himself up… AND JASON CHARGES HIM… PUNT TO THE HEAD! PUNT TO THE HEAD!

Russillio: MALCOLM PULLS HIMSELF OUT OF HARMS WAY WITH A SPLIT SECOND TO SPARE! MALCOLM GETS BEHIND JASON AND ROLLS HIM UP!

ONEEEEE! TWOOOOOOOOOOOOOOOOO!

Russillio: JACK RIPLEY BREAKS IT UP! HE SLIDES INTO THE RING BEFORE THE COUNT OF THREE! Jack Ripley with a huge save in this match. All three men begin to get up! Malcolm is up and Jack fires a elbow right at him! He staggers but fires a shot back! Jason comes in as he hooks the waist of Jack Ripley! GERMAN SUPLEX! JACK RIPLEY COUNTERS BY FIRING SEVERAL ELBOWS TO BREAK JASON’S HOLD! HERE COMES MALCOLM WITH A CLOTHESLINE AS JACK DUCKS SO THAT MALCOLM TAKES OUT JASON MCKORMICK INSTEAD!

James Peters: Jack Ripley now spins Malcolm around! HE PULLS HIM IN AND EXECUTES A SNAP SUPLEX! JACK SPINS AROUND… SPRINGBOARD FOREARM SMASH! POP INSERTS HIMSELF BACK INTO THIS MATCH! IT SENDS JACK RIPLEY FOR A LOOP! JASON NOW COMES AT POP WITH A RIGHT HOOK BUT HE CATCHES IT AND SENDS A PUNCH OF HIS OWN! Malcolm Jones now begins to get up! POP throws another right hook to Jason who stumbles towards Jones who catches Jason with a shot of his own! Jason fires back at Malcolm as each man fight for the advantage… AND THEY BOTH TURN TOWARDS POP… SPRINGBOARD CROSSBODY! POP CRASHES INTO BOTH MEN TAKING OUT BOTH MALCOLM AND JASON!

Russillio: POP now goes to execute his next course of action… DAYLIGHT SLAYING TIME! RUNNING KNEE TO THE HEAD OF POP! JACK RIPLEY CAUGHT HIM AS POP GOES TUMBLING OUT OF THE RING! Jack now turns towards Malcolm… C-NOTE! THE SPEAR BY MALCOLM! BUT IT MISSES JACK AND HE DRILLS JASON MCKORMICK WHO HAD JUST GOTTEN UP BEHIND JACK! MALCOLM IS SPUN AROUND BY JACK AFTER HITTING THE SPEAR… YOU’LL FLOAT TOO! SUPERKICK FLUSH TO THE JAW AND MALCOLM FALLS LIFELESS OUT OF THE RING OVER THE TOP ROPE!

James Peters: JACK MAKES HASTE AND CLIMBS TO THE TOP ROPE! I CAN’T BELIEVE WHAT I’M SEEING! HE’S ON THE TOP ROPE…. NO WAY! BELIEVE IT OR NOT! SHOOTING STAR PRESS TO JASON MCKORMICK! JACK RIPLEY FROM BEING FIRED ON DYNASTY TO WINNING KING OF ELITE! HE COVERS!!!!

ONEEEEEE! TWOOOOOOOOOOOOOO! THREEEEEEEEEEEEEEEEEEEE—-

Russillio: WHAT?! KICK OUT! KICK OUT! KICK OUT! JASON MCKORMICK KICKS OUT AND THIS CROWD IS GOING WILD! EVERYBODY IN THIS BUILDING MUST HAVE THOUGHT THIS MATCH WAS OVER! JACK EXECUTED THOSE SEQUENCE OF EVENTS TO PERFECTION AND IT STILL WASN’T ENOUGH! Jack Ripley is completely stunned. He’s just looking at Jason in complete disbelief and I don’t blame him! That was a stunning Shooting Star Press and yet Jason endured it!

James Peters: Jack Ripley picks up Jason McKormick! He pulls him in and carries out another Snap Suplex! He now steps back as Jason slowly begins to stir… YOU’LL FLOAT TOO… HE’S CUT OFF BY POP! POP ENTERS THE FRAY AND CATCHES JACK WITH A FLURRY OF RIGHTS AND LEFTS! HE NOW DELIVERS A SWIFT KICK TO THE GUT OF JACK RIPLEY WHO DOUBLES OVER! POP NOW STEPS BACK FOR SOME REASON… IT’S MALCOLM JONES! HE COMES DIVING FROM THE TOP ROPE… THE RE-UP DIVING LEG DROP! CONNECTS ONTO JACK RIPLEY! PELE KICK BY POP! BUT MALCOLM JUMPS BACK IN THE NICK OF TIME!

Russillio: JASON COMES FROM THE SIDE OF MALCOLM AFTER DODGING THAT PELE KICK AND CATCHES HIM WITH A JUMPING KNEE SMASH! MALCOLM GOES DOWN ONCE MORE! JASON TURNS HIS SIGHTS TO POP… PELE KICK! NO WAY! PELE KICK TO JASON MCKORMICK! JASON GOES DOWN JUST LIKE MALCOLM! POP NOW TURNS TO JACK WHO’S BARELY BEGINNING TO STIR!

James Peters: HE PICKS HIM UP! CROWN!! OF!!! THORNS!!! THE STYLES CLASH BY POP PLANTS JACK RIPLEY! THE EAW HALL OF FAMER FALLS ON TOP OF RIPLEY! HE HOOKS A LEG! I CAN’T BELIEVE IT!

ONEEEEE! TWOOOOOOOOOOOOOOOOOOOOOOOOOOO! THR——

James Peters: KICKOUT! JACK KICKS OUT! JACK RIPLEY ISN’T DONE! HE REFUSES TO! ALL OF THESE MEN JUST CONTINUE TO FIGHT IN HOPES OF BEING CROWNED KING OF ELITE! POP falls off of Jack exhausted as him, Jason, and Malcolm begin to stir in the ring! Malcolm Jones approaches POP as POP gets to his feet. He pushes POP into the nearby corner with a series of lefts and rights! He steps back and charges in for a clothesline! POP SIDE STEPS IT! Malcolm runs into the turnbuckles as POP takes advantage.

Rich Russillio: POP delivers a forearm that rocks Malcolm! POP now steps back as he prepares to charge… AND JACK RIPLEY COMES IN FROM BEHIND! GERMAN SUPLEX! HE SENDS POP FLYING BEHIND HIM! MALCOLM CHARGES HIM AND JACK CATCHES HIM WITH AN ELBOW! JASON MCKORMICK NOW COMES IN WITH A RUNNING FOREARM THAT CONNECTS TO THE JAW OF JONES CAUSING HIM TO FALL OVER! JASON NOW KICKS JACK RIPLEY IN THE MIDSECTION AS HE FALLS OVER… DINNER TIME! CURB STOMP… BUT JACK JUMPS BACK AND CONNECTS WITH A DOUBLE KNEE BACK BREAKER TO JASON!

James Peters: Jack quickly turns to Malcolm Jones… YOU’LL FLOAT TOO! HE FIRES AWAY WITH THE SUPER KICK! BUT MALCOLM IS QUICK TO DODGE! JACK TURNS TO FIND HIM BUT IS MET WITH AN ENZUIGIRI! JONES HITS IT TO THE SKULL OF JACK WHO FALLS OVER! THERE’S POP ONCE MORE! HE COMES IN WITH A DROP KICK TO MALCOLM WHO STUMBLES INTO THE CORNER BEHIND HIM! POP COMES IN WITH A RUNNING CLOTHESLINE!

Rich Russillio: MALCOLM JONES JUMPS TO THE SIDE AS POP MEETS THE TURNBUCKLE INSTEAD! ENZUIGIRI! JONES HITS THE ENZUIGIRI ON POP! HE NOW GRABS POP… BUCK 50! THERE IT IS! THE TORNADO FACEBUSTER! IT CONNECTS! MALCOLM JONES ABSOLUTELY DRILLS IT ONTO THE PRINCE OF PHENOMENAL! HE COVERS! THIS HAS TO BE IT!

ONEEEEEE! TWOOOOOOOOOOOOOOO! THR——-

James Peters: THIS IT IT— NO! JASON MCKORMICK COMES IN TO BREAK IT UP! HOW CLOSE CAN YOU POSSIBLY GET AS JONES AND JASON FALL OVER EXHAUSTED, BEATEN, AND BATTERED! Malcolm crawls to the ropes to pull himself up as Jason does the same! Both men stumble towards one another as Malcolm gets the upper hand with a european uppercut! Jason falls back… AND EXPLODES BACK TO MALCOLM WITH A JUMPING CLOTHESLINE! HE TAKES JONES DOWN!

Rich Russillio: Jason now lifts Malcolm back up! He connects with a european uppercut! Malcolm is reeling! Look there! On the top rope! IT’S JACK RIPLEY! WHILE JASON AND MACOLM ARE DUKING IT OUT, JACK HAS HIS SIGHTS SET ON POP WHO IS STILL MOTIONLESS IN THE RING! HE LEAPS! BELIEVE IT OR NOT! SHOOTING STAR PRESS! NO!!! POP ROLLS OUT OF THE WAY AS JACK CRASHES INTO THE RING MAT! Jason and Malcolm both jumped back out of the way as Jack misses!

James Peters: JASON NOW GOES RIGHT BACK TO FIRING AT MALCOLM! POP NOW ROLLS TO THE RING APRON! HE SPRINGBOARDS TOWARDS JASON WHO DUCKS OUT OF THE WAY AS POP DRILLS MALCOLM JONES WITH THAT SPRINGBOARD FOREARM SMASH! JASON NOW COMES FROM BEHIND POP… THE LEGACY! HE FIRES AWAY A SUPER KICK! BUT POP DUCKS! SCOOP SLAM! HE CATCHES JASON MCKORMICK WITH A SCOOP SLAM!

Rich Russillio: Jack Ripley now gets to his feet after missing that shooting star press on POP! DAYLIGHT SLAYING TIME! HE FIRES AWAY AS POP! BUT POP SIDESTEPS IT! MALCOLM JONES NOW GETS UP TO CATCH POP WITH A DROP KICK! POP GOES DOWN AFTER THAT DROP KICK! JACK RIPLEY NOW COMES IN TO GRAB MALCOLM BY THE WAIST! MALCOLM FIRES BACK WITH SEVERAL ELBOWS TO THE JAW OF RIPLEY! RIPLEY FALLS BACK… AND THERE’S JASON MCKORMICK WITH A CLOTHESLINE TO TAKE DOWN MALCOLM JONES!

James Peters: JACK NOW COMES IN WITH A CLOTHESLINE TO JASON BUT HE DUCKS! POP NOW COMES IN FROM BEHIND TOWARDS JACK! THE LEGACY! HE FIRES AWAY AT JACK RIPLEY… BUT JACK DUCKS! THE SUPERKICK MISSES JACK AND INSTEAD HITS POP WHO WAS COMING UP BEHIND! YOU’LL FLOAT TOO! A SUPERKICK FROM JACK RIPLEY THIS TIME! IT DRILLS JASON MCKORMICK! JASON REMAINS ON HIS FEET AS HE’S STUMBLING ABOUT TO FALL!

Rich Russillio: NO WAY! C-NOTE SPEAR TO JACK RIPLEY FROM MALCOLM JONES… NO JACK DODGES IT! IT DRILLS JASON MCKORMICK! THE SPEAR TO JASON! JONES COMES OUT OF NOWHERE WITH THE SPEAR! MALCOLM GETS UP! JACK RIPLEY HAS HIM IN HIS SIGHTS!

James Peters: PELE KICK! POP WITH A PELE KICK TO JACK RIPLEY! POP STANDS AFTER HITTING THE PELE KICK! HE TURNS AND CHARGES MALCOLM JONES! MALCOLM SIDES STEPS A CLOTHESLINE ATTEMPT! POP TURNS AROUND…. UPTOWN RIDE! THE SKY HIGH CONNECTS AND JONES SLAMS HIM DOWN! THERE’S JASON MCKORMICK! HOW IN THE HELL HE CAN STILL STAND IS BEYOND ME… JUMPING KNEE SMASH! IT CATCHES MALCOLM JONES! I CAN’T BELIEVE IT!

Rich Russillio: JASON MCKORMICK NOW PULLS MALCOLM JONES! DINNER TIME! HE GOES FOR THE CURB STOMP! NO FREAKING WAY!!!! WAIT! JACK RIPLEY FIRES AWAY FROM BEHIND! YOU’LL FLOAT TOO! HE FIRES AWAY A SUPERKICK ONCE MORE! BUT IT MISSES IT’S MARK! JASON TURNED JUST IN TIME TO SEE IT AND DUCKS! JACK TURNS AROUND… JUMPING KNEE SMASH! JASON NOW PUTS HIM DOWN… DINNER TIME! HE DRILLS THE CURB STOMP AS JACK RIPLEY’S SKULL IS DRIVEN INTO THE GROUND!

James Peters: JASON GOES FOR THE COVER! THIS IS IT! C-NOTE! DROP KICK! A DROP KICK FROM MALCOLM JONES CATCHES JASON! MALCOLM JONES GRABS JASON… HE HAS HIM! BUCK 50! BUCK 50! BUCK 50!!!! THE TORNADO FACE BUSTER! MALCOLM JONES HITS IT! HE COLLAPSES ON TOP OF JASON MCKORMICK! FOR THE KING OF ELITE CROWN!!!!!

ONEEEEEEEEEEEEEEEEEEEEEEEEE! TWOOOOOOOOOOOOOOOOOOOOOOOOOOOOO! THREEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE!

(Ding! Ding! Ding!)

James Peters: KING OF ELITE! MALCOLM JONES CLAIMS THE CROWN! HE’S THE 2019 KING OF ELITE! WHAT A THRILLING MATCH AND CONCLUSION! MALCOLM JONES PERSEVERES AND CLAIMS THE CROWN!

(“Pray For Em” by Meek Mill plays as the crowd erupts as one half applauds and showers Malcolm Jones with cheers as the other half releases deafening boos. Malcolm Jones lies motionless in the ring for several moments before mustering the strength to stand. He stumbles about as the referee holds up his hand as excitement begins to wash over him.)

Bella Braxton: HERE IS YOUR WINNER…. AND THE 2019 KING OF ELITE… MALLLLCOOOLLLMMMMMMMM JONNEEEESSSSSSSSSSS!

Rich Russillio: MALCOLM JONES NOW ADDS THE KING OF ELITE CROWN TO HIS RESUME! NOW HE HAS SOMETHING TO ACCOMPANY HIS INTERWIRE CHAMPIONSHIP AS HE CONTINUES TO CAPTIVATE EAW! FOR THE THIRD STRAIGHT YEAR, SHOWDOWN LEAVES KING OF ELITE WITH THE CROWN! THOUGH THEY DIDN’T WIN, JASON, JACK, AND POP WERE PHENOMENAL IN THIS MATCH!

James Peters: You’re absolutely right! This match came down to being in the right place at the right time as so much was happening with all four men! Malcolm Jones played it perfect and after enduring so much punishment, he perseveres! These four men dealt out so much punishment to one another, and yet they kept going to fight for the crown!

Rich Russillio: Malcolm Jones walked into King of Elite as Interwire Champion, now he exits as both a champion and a king!

(The referee is shown handing the King of Elite crown and Interwire Championship to Malcolm Jones. Malcolm then places the crown on his head. The camera then displays the throne on the stage as Malcolm Jones begins to eye it. He then slowly walks up the ramp before taking a seat with the Interwire Championship on his shoulder and crown on his head.)

Rich Russillio: Even though they didn’t win, Jason McKormick, Jack Ripley, and Prince of Phenomenal all showed why they were worthy to be here, but in the end, it’s Malcolm Jones who endured the longest.

James Peters: I can’t help but be amazed at how Malcolm pulled off the win. Right up until the final bell, I had no idea who would walk away victorious.

(Camera opens to see Gina Romano standing in the ring with a microphone, the EAW regulation steel cage hanging above the ring)

(“Odee” by A Boogie hits to massive cheers as Chris Elite comes out accompanied by Big Mike. Chris looks loose, bouncing on the balls of his feet while wearing his pink mink.)

Eve: Here comes the former World Heavyweight Champion himself! Chris Elite activates his Gawd Contract on the last episode of Showdown! He chose to change the stipulation of this match from a Falls Count Anywhere to a Steel Cage in the hopes of removing any outside interference from Kassidy Heart. I gotta say, a bold but wise move. Ahren Fournier will have no choice but to take this match purely one on one.

(Chris steps up to one of the camera’s on his way down.)

Chris Elite: Yeah. This right here is my time. To be the Elite Champion you gotta be Elite. That’s me baby! Big Bhris Elite!

Deadprez: Look, you ain’t gonna find someone who pulls for Chris Elite as much as me. But saying it as if being locked in that cage is an advantage for Chris ain’t right. He’s still gonna be in there with one of the best in this company. Don’t be shocked if this turns out to blow up in Elite’s face right here.

(Chris hands his mink to Big Mike before climbing up into the ring, pausing to look up at the cage hanging above and taking a deep breath.)

(“Starboi” by The Weeknd hits to thunderous boos as Ahren Fournier comes out with Kassidy Heart at his side as they ride on a chariot shaped like the head of a goat. They both wear their ring gear with matching black fur coats, the ends of each follicle appear to have been dipped in gold as each wear their respective title. Ahren has the EAW Championship around his waist and Kassidy has her Vixen’s Championship around hers. They climb out of the chariot at the top of the stage and Ahren walks with his umbrella as if it were a cane.)

Deadprez: And here comes the single greatest pairing in the history of EAW! The GOAT himself and the golden goddess! Magnum Opus has taken the EAW Universe by storm! They are the most gorgeous, most talented, most valuable duo in the company! They are—

Eve: So you stan, DP?

Deadprez: I stan, Eve. I stan.

Eve: Ahren Fournier is walking into a serious challenge tonight. There’s few who have the athletic capability of Chris Elite. But the technical ability of Ahren will price to test Chris just as heavily. These two hold no love for each other however. Recent weeks have left them bitter to each other and I don’t think either can wait to get their hands on the other.

(Ahren removes his coat and hands it and his umbrella to Kassidy who hands them to a valet boy who has just run to hold them during the match because she’s too perf to be forced into menial labor.)

(Ahren walks into the ring and eyes Chris but not before glancing up at the steel cage, nodding his head. He removes the EAW Championship from his waist and looks at it, hesitating before handing it to the referee.)

(The referee shows the title to both men, they each nod before the referee holds it in the air for the crowd and hands the title out to the time keeper. The cage then begins to lower around them, trapping everyone inside.)

Gina Romano: Ladies and Gentlemen… The following contest is a STEEL CAGE MATCH! AND IT IS FOR THE EAW CHAMPIONSHIP!!!

Crowd: WOOOOOOOOOOOOOOOOOO!!!

Gina Romano: The only way to win is by pinfall or submission, or by escaping the cage with both feet touching the floor.

(The cage finishes lowering and the other referees take their positions on the outside)

Gina Romano: Introducing first, the challenger… from Brooklyn, New York, weighing in at two hundred and ten pounds… he is GAWD GIVE GREATNESS…. CHRRRRRRRIIIISSSSSSSS EEEEEELLLLIIIITTTTTEEEEE!!!!!!

Crowd: BHRIS BHRIS BHRIS BHRIS BHRIS!!!!

(Chris raises his fist in the air, not taking his eyes off of Ahren.)

Gina Romano: And Introducing the champion… from Pawtucket, Rhode Island, weighing in at two hundred and ten pounds… he is the GOAT… and he is the reigning EAW CHAMPION!!!! AHHHHRRRRRREEEEEEEENNN FFFFOOOUUURRRRNNNIIIIEEEERRRRR!!!!!!!!!!!!!

Crowd: BOOOOOOOOOOOOOOOOOOO!

Kassidy Heart (off-mic): BAAAAAA BAAAAAAA BAAAAAAAAAAAAA!

(Ahren puts both his hands out, happily soaking in the crowds reaction, a cocky grin on his face as he stares right back at Chris)

(Gina exits the ring through one of the cage’s side doors as the referee helps her down from the apron before locking the door. The referee looks at both men to check that they are ready)

(DING! DING! DING!)

Eve: AND WE ARE OFF IN THIS EAW CHAMPIONSHIP CAGE MATCH! AND CHRIS ELITE JUST CHARGED FOR AHREN FOURNIER!!! WASTING NO TIME AS HE SMASHES THE CHAMPION WITH A FOREARM TO THE NOSE! AHREN STUMBLES BACK! HES TAKEN OFF-GUARD BY THE SUDDEN ASSAULT AND CHRIS PRESSES! CHRIS TRIES TO GET AHREN AGAINST THE CAGE FOR PUNISHMENT! OH BUT AHREN ROLLS THROUGH WITH A SCISSOR SWEEP TAKEDOWN!

Deadprez: Ahren slides himself over into a side control headlock! Trying to control Chris while he gets his bearings! But look! Chris kicks his legs! HE SLIPS THE HEADLOCK! CHRIS SLIDES BEHIND AHREN AND TRIES TO APPLY THE REAR NAKED CHOKE! OH BUT AHREN SLIPS THROUGH THAT AND ROLLS OVER TO PRESS CHRIS’ SHOULDERS TO THE MAT!

Ref: ONEEEEEEEEE!

Eve: Chris gets a shoulder up before dropping back down to pull his legs up and put his feet into Ahren’s stomach and shove him up and and into the cage wall! CHRIS JUST KIPPED UP FROM THE MAT AS AHREN BOUNCES OFF THE CAGE! BOX OFFICE SMASH!

Deadprez: AHREN SLIPPED OUT OF THE WAY OF THE SUPERKICK! Chris elite is hung up by the leg on the top rope now! AHREN WITH A ROUNDHOUSE KICK TO THE SKULL OF CHRIS ELITE AND CHRIS DROPS TO THE MAT! Ahren sees him down! AHREN RUNS FOR THE SIDE DOOR OF THE CAGE! Ahren is yelling at the ref to unlock it!

Ahren Fournier (off-mic): GO FASTER FUCK FACE!

Eve: Big Mike is there now! He’s telling the ref not to open the cage door but he doesn’t get that option and now—

**CLANG**

Eve: KASSIDY HEART IS HURLING STEEL CHAIRS AT BIG MIKE!

**CLANG**

Kassidy Heart (off-mic): GET FUCKED YOU OVERSIZED, OVER-STEROIDED MILK DUD!!

**CLANG**

Eve: DEAR GOD SHE ISN’T STOPPING! She keeps pulling these chairs from ringside and throwing them at Big Mike! BUT THE REFEREE FINALLY HAS THE DOOR UNLOCKED! AHREN SLIPS OUT THROUGH THE ROPES AND HOPS DOWN—

Deadprez: BUT CHRIS ELITE IS BACK UP AND JUST GRABBED HIM BY THE MAN BUN! CHRIS USING ALL HIS STRENGTH TO HOLD ON AND AHREN IS REACHING!

Eve: HIS RIGHT FOOT JUST TOUCHED THE FLOOR!!

Deadprez: IF HE CAN REACH WITH HIS LEFT FOOT ITS ALL OVER!

Eve: BUT CHRIS IS PULLING WITH ALL HE HAS! OH MY GAWD HE’S ACTUALLY PULLING AHREN BACK IN BY THE HAIR! HE YANKS AHREN BACK UP AND DRAGS HIM OVER THE TOP ROPE! Ahren falls with a thud to the mat as he looks up in disbelief to see the referee locking the door again before looking back at Chris who LEAPS INTO THE AIR AND DELIVERS A DOUBLE FOOT STOMP TO AHREN!

Deadprez: Ahren clutches his ribs in pain, but Chris gives him no time to recover as he pulls him to his feet! Chris goes to irish whip Ahren into the far corner, but Ahren reverses! Chris CRASHING into the turnbuckle, slumped over and stunned! Now Ahren charging towards Chris BUT CHRIS WITH A BIG BOOT! AHREN IS STUNNED ON HIS FEET, and Chris grabs him by the wrist…CHRIS SPRINGBOARDING NOT JUST OFF THE ROPES, BUT ALSO THE CAGE! ELITE CUTTER! WRISTLOCK SPRINGBOARD CUTTER DOWNS THE EAW CHAMPION! CHRIS GOING FOR THE PIN!

Referee: ONEEEEEEE! TWOOOOOOO!

Eve: KICKOUT BY AHREN! That cutter took him down, but it hasn’t put him out of this match for good! Chris wasting no time now as he climbs to the top rope! He might be looking to finish this match early with a high risk move!

Deadprez: BUT WAIT! Kassidy Heart is shaking on that cage and taunting him from the outside! She’s trying to distract Chris Elite, and it’s working!

Chris Elite (off-mic): Can we get some bitch control out here?

Eve: Kassidy Heart getting under the skin of Chris El- OH MY GOD BIG MIKE NOW GRABBING HER FROM BEHIND! HE’S PULLING HER AWAY FROM THE CAGE AS SHE STRUGGLES!

Kassidy Heart (off-mic): GET OFF ME YOU FREAK!

Deadprez: KASSIDY WITH A KNEE RIGHT TO BIG MIKE’S LITTLE MIKE! She retreats away from the cage, Big Mike struggling to walk as he follows her, making sure she stays away from my boy BIG BHRIS ELITE!

Eve: With no distractions, Chris is focusing on the still-downed Ahren! CHRIS LEAPS OFF THE TOP ROPE – HE’S GOING FOR A FROG SPLASH!

Deadprez: BUT AHREN WITH THE KNEES UP! CHRIS’ RIBS JUST GOT DRIVEN INTO THE EAW CHAMPION’S KNEES, AND NOW HE’S JUST A CRUMPLED HEAP ON THE MAT! Kassidy’s distraction worked long enough for Ahren to recover, as he gets to his feet! Ahren eyeing the cage with Chris still down…he jumps over the ropes and onto the apron, and begins to CLIMB THE CAGE!

Eve: Ahren eager to escape this match and secure victory it seems! He’s already called for the door to be open, and now he’s taking the first chance he can get to try and climb the steel! He’s up past the middle rope, now past the top rope! Ahren looking a little slow, no doubt still groggy from that Elite Cutter, but he’s just over halfway up the cage!

Deadprez: CHRIS ELITE BACK TO HIS FEET THOUGH! He’s groggy too as he climbs up the ropes, perching on the top and middle ropes…CHRIS GRABBING AHREN BY THE WAIST BEFORE AHREN CAN CLIMB OUT OF REACH! ELEVATED GERMAN SUPLEX!

Eve: BOTH MEN COME CRASHING DOWN TO THE MAT, WHAT IMPACT! AHREN ISN’T MOVING AT ALL, AND CHRIS IS STRUGGLING! Chris the first to show signs of life now as he inches his way across the mat towards Ahren! Ahren showing some slight movement, but CHRIS WITH THE COVER!

Referee: ONEEEEEEE! TWOOOOOOO! THR–

Deadprez: AHREN WITH THE KICKOUT! HE LOOKED TIRED AS HELL DOING IT, BUT HE KICKED OUT OF THAT PIN! Chris looks shocked, he can’t believe Ahren survived that impact! He hits the canvas in frustration before getting to his feet, dragging Ahren up with him! Chris with one punch to Ahren’s head, followed by ANOTHER! SHOOT KICK, CHRIS IS LOOKING TO COMPLETE THE 5 BOROUGH COMBO! A BACK FIST ROCKS THE ALREADY STUNNED AHREN FOURNIER, AND NOW CHRIS PULLING BACK! LARIAT!

Eve: AHREN DUCKS UNDER IT! HE HAS A HOLD ON CHRIS’ ARM AS HE SLIPS UNDER THAT LARIAT AND HE PULLS HIM IN…RIPCORD KNEE STRIKE! THE CLIMAX JUST STUNNED CHRIS! Chris Elite now dropping to one knee and Ahren rears back…SUPERKICK TO THE HEAD OF CHRIS ELITE! Chris falling back onto the mat as Ahren falls against the ropes, clutching his ribs once again!

Deadprez: That big elevated German suplex and double foot stomp from earlier must have had a lot of impact on the body of the EAW Champion! And that is not good in a match like this where it seems like both men are trying to go the distance. No wonder Ahren has been eager to end this quickly, he can’t let any more damage build up!

Eve: Ahren looks to have recovered now as he comes away from the ropes, and Chris is struggling to get to his feet! There’s some distance between them, and Ahren is eyeing an opportunity! Ahren charging towards Chris Elite, he leaps…CURB STOMP! STORYBOOK ENDING!

Deadprez: CHRIS ELITE REVERSING IT! HE GOT UP JUST IN TIME AND HAS CAUGHT AHREN! He has Ahren up in a fireman’s carry, Ahren is struggling despite the look of pain on his face! Chris could be looking for the FACE VALUE HERE!

Eve: AHREN ISN’T GIVING UP THOUGH! He plants Chris with an ELBOW TO THE HEAD! ANOTHER! Chris looking groggy as he struggles to keep Ahren up in that fireman’s carry! Ahren hitting him with a third STIFF ELBOW, and that forces Chris to drop Ahren! Both men groggy, but Ahren STRIKING FIRST WITH A HARD KICK! HE FOLLOWS IT UP QUICKLY WITH A STIFF PUNCH TO THE HEAD, AND FINALLY AHREN WITH A HARSH KNEE TO THE JAW OF CHRIS ELITE! Ahren grabbing the stunned Chris and IRISH WHIPPING HIM FACE FIRST INTO THE STEEL CAGE! The cage rattling at that impact as Chris falls to the mat!

Deadprez: Ahren looking to get back in this now as the momentum shifts to him! He climbs up onto the middle rope in the corner…DOUBLE FOOT STOMP TO CHRIS ELITE! HE GOT A LITTLE PAYBACK THERE FOR CHRIS’ EARLIER ATTACK! Ahren now taking advantage of the downed Chris, he grabs one of his wrists and brings his arm up…NOW GRABBING ONTO CHRIS’ FINGERS, I DON’T THINK I WANNA HEAR WHAT’S GONNA HAPPEN NEXT!

Ahren Fournier (off-mic): Let’s see you climb the cage now, bitch!

Eve: GET FUCKED! THE FINGER SNAP! THAT SICKENING CRACK JUST ECHOED AROUND THE ARENA! Ahren being ruthless here, vengeful even after Chris tried to damage his chances of a quick finish! He lets Chris’ hand drop to the mat, delivering a HARD STOMP TO THOSE SNAPPED FINGERS FOR GOOD MEASURE!

Deadprez: Chris not giving up though! He’s trying to get to his feet, and Ahren dragging him up now, taking the opportunity to taunt him!

Ahren Fournier (off-mic): I’M THE GOAT, you want me to spell it out for you? G.O.A-

Eve: CHRIS SPITTING IN THE FACE OF AHREN! Ahren looks pissed as Chris gets up, a cocky grin on his face! AHREN DRAWING BACK AND GOING FOR A CLOTHESLINE FROM HELL!

Deadprez: CHRIS TAKING ADVANTAGE OF AHREN’S ANGER AND DUCKING UNDER HIS ARM! Ahren turning around INTO A PELE KICK FROM CHRIS! Ahren stumbles back from that kick, falling into the corner behind him! Chris to his feet, he runs to the opposite corner and starts charging towards Ahren…357! CHRIS WITH THE RUNNING DOUBLE KNEE FACEBUSTER TO AHREN! HE’S GOTTEN BACK HIS ADVANTAGE!

Eve: With Ahren hurting on the floor, Chris looks up at the cage…AND STARTS TO CLIMB UP THE TURNBUCKLE! Those finger snaps clearly doing their job as Chris is visibly struggling to hold himself up as he ascends the cage, but that adrenaline is keeping him going! Chris is over halfway up the cage…NOW HE’S ALMOST NEAR THE TOP! ONE HAND REACHES UP, HE’S GOT HIS FINGERS WRAPPED AROUND THE TOP OF THE STEEL CAGE! HE JUST NEEDS TO PULL HIMSELF UP WITH THAT HURT HAND!

Deadprez: BUT AHREN IS NOW UP, AND HE’S GRABBING ONTO CHRIS’ LEG! Ahren yanking on that leg, and Chris fighting to stay where he is! Chris KICKING AHREN WITH HIS FREE LEG, AND AGAIN! Ahren still holding on, but a THIRD KICK FROM CHRIS is enough to knock him away! Ahren crashes to the mat! Chris looking up at the top of the cage, then down at Ahren who’s laid out…

Eve: CHRIS LEAPS OFF OF FROM THE CAGE, USING IT TO BOOST HIM! DOUBLE ROTATION MOONSAULT ONTO AHREN FOURNIER! YOU GOTTA LOVE IT!

Deadprez: BUT AHREN GETS THE KNEES UP AND CHRIS CRASHES STERNUM FIRST INTO THE KNEES OF THE CHAMP! What a visual that move was but it didn’t pay off for Chris!

(Slow motion replay of Elite getting a flawless double rotation of the moonsault off the cage before crashing into Ahren’s knees)

Eve: You can tell he saw his opportunity to end this and pick up the win with a pinfall rather than just escaping the cage. He wants to win and prove he’s the better man.

Deadprez: Well whichever is better, both men are motionless right now. Chris is clutching his abdomen and now he’s… oh he just rolled over and he’s coughing up blood! Chris Elite has some internal injuries after that crash and burn! Ahren Fournier is trying to drag himself to the ropes to pull his way to his feet! He got those knees up but he’s feeling everything he’s been through already in this matchup!

Eve: KASSIDY HEART! SHES GETTING INVOLVED AGAIN! SHE JUST SLID AHREN’S UMBRELLA THROUGH THE CAGE GRATE! SHE SLIDES IT RIGHT IN FRONT OF THE EAW CHAMPION WHO IS GRINNING LIKE A SUPERVILLIAN RIGHT NOW!

Deadprez: Ahren is pushing his way to his knees, climbing to his feet, using the umbrella to prop himself up! He gets to his feet and he composes himself! Ahren now picks up the umbrella and holds it behind his head like a hitter in a home run derby, looking to swing for the fences!

Big Mike (off-mic): AINT NO RAIN IN HERE! GET THAT SHIT OUT!

Eve: Ahren’s stalking Chris Elite who has barely managed to even get his knees under him! Chris is climbing his wa up, slowly but surely, using his forearm to wipe the blood from his mouth! This is what he is willing to go through for the EAW Championship! Ahren is staying just out of eyesight behind Chris! Chris up to one foot now! He pushes his way to two feet! He’s getting his bearings about him! He turns—

Deadprez: AHREN SWINGS FOR ELITE’S SKULL!!! FULL FORCE!!!!

Eve: BUT CHRIS GETS HIS ARM UO AND CATCHES THE UMBRELLA IN HIS ARMPIT! CLOSES HIS ARM DOWN TO TRAP THE UMBRELLA! HE JUST GLARES BACK AT AHREN AND SHAKES HIS HEAD TO SAY “NOT GONNA HAPPEN”!!!!

Deadprez: Chris yanks the umbrella away before tossing it to the corner away from Ahren! Chris winces as he grabbed the umbrella because of those popped fingers! BUT AHREN ISNT HAPPY AND COMES IN WITH FOREARM SHOTS! HES BASHING INTO THE FACE OF CHRIS ELITE WHO TRIES TO COVER UP BUT HES TAKING A LOT OF DAMAGE!

Eve: AHREN NOW SWITCHING TO GUT PUNCHES! HE KNOWS ELITE IS INJURED IN THE ABDOMEN AND TRYING TO ADD TO THE SUFFERING! ELITE IS DOUBLED OVER NOW! MORE BLOOD COMING FROM HIS MOUTH! BUT AHREN GRABS THE HEAD! POP UP SUPLEX! ELITE PLANTED LIKE DEAD WEIGHT AND AHREN TRYING TO LOCK IN THE CROSSFACE CHICKENWING TO COMPLETE THE LULLABY!

Deadprez: CHRIS IS LIFELESS AFTER THAT SUPLEX TO HIS DAMAGED TORSO! AHREN HAS THE CROSSFACE AND CHRIS IS JUST FIGHTING THE CHICKENWING OUT OF SHEER INSTINCT! BUT AHREN GRABS THE ARM AND FINISHES LOCKING IT IN! THE LULLABY IS APPLIED!

Eve: CHRIS ELITE IS ALREADY LIFELESS! The referee grabs his hand and lifts it… OH HIS HAND BEGINS TO DROP BUT HE WAKES UP JUST IN TIME! CHRIS ELITE IS SCRAMBLING, RUNNING HIS FEET AROUND! LOOKING FOR SOMETHING! SOME WAY TO ESCAPE!

Deadprez: BIG MIKE TRYING TO WILL HIS MAN ON FROM THE OUTSIDE BUT I DONT KNOW THAT CHRIS CAN MAKE IT OUT OF THIS! THE HOLD IS LOCKED IN DEEP! CHRIS IS STRUGGLING BUT HES ALREADY BEEN THROUGH A LOT! HES FADING!

Eve: HES OUT! CHRIS HAS STOPPED MOVING AND I THINK THE REFEREE WILL HAVE TO—

Deadprez: CHRIS JUST LURCHED BACK WITH HIS FEET AND FLIPPED HIMSELF OVER! He curled himself up and gets his toes on the mat while Ahren is still on the ground with the submission applied! AHRENS SHOULDERS ARE DOWN!!

Ref: ONEEEEEEEEEE! TWOOOOOOOOOOOOOO! THREEEEEEEEEEEEEEEEEEEEEEE!

Eve: AHREN RELEASED THE HOLD AT THE LAST POSSIBLE INSTANT!

Deadprez: He wanted to apply every ounce of punishment he could with the Lullaby before he had to let go! The Champion rolls over and pushes his way up to his feet as Chris Elite is leaned against the ropes, trying to get blood flow back to his head and limb! Ahren tried to grab ahold of Chris… BUT CHRIS GRABS AHREN INSTEAD! HE SMASHES THE CHAMPION FACE FIRST INTO THE STEEL CAGE! HE GRATES THE GOATS PERFECT FACE AGAINST THE CAGE!

Eve: Several cuts now open on the face of Ahen, particularly looking like that skinned his nose… Chris pulls him off and bashed his head back and forth against the cage! Now Chris pulls him away… AND RUNS HIM SKULL FIRST BETWEEN THE TOP AND MIDDLE ROPES INTO THE CENTER SUPPORT BEAM OF THE CAGE WALL! THAT COULD LEAVE THE CHAMPION WITH A CONCUSSION! Ahren looks like he’s having trouble staying on his feet… CHRIS PULLS HIM ONTO POSITION! BROOKLYN HIGH!!!

Deadprez: THE SPANISH FLY CONNECTS AND CHRIS DRAPES HIS ARM OVER THE GOAT!

Ref: ONEEEEEEEEE!!!!! TWOOOOOOOOOOOOOO!!!!! THREEEEEEEEEEEEEEEEEEEEEEE!!!!

Eve: AHREN STILL GETS THE SHOULDER UP! THE CHAMPION WILL FIGHT ON! Chris looks frustrated but unsurprised! Chris clutches his hurting body as he drags himself to his feet again! Chris reaches down and grabs Ahren! Tries to yank him to his feet in a rear waist lock… BUT THE BACK ELBOWS FROM THE GOAT!

Deadprez: Chris Elite stumbles back into a corner and now here comes Ahren with a forearm! He rushes to the corner to try and deal some more punishment to Elite and now with kicks to that damaged midsection! Over and over with these kicks and not holding anything—

Eve: CHRIS JUST CAUGHT ONE OF THE KICKS! HE SHOVES AHREN BACKWARDS BY THE FOOT! CHRIS CLUTCHES AT HIS STOMACH AND LOOKS TO COME OUT THE CORNER ON THE OFFENSIVE…

Deadprez: PROTECT YA NECK! AHREN WITH THE CLOTHESLINE FROM HELL AND IT JUST TURNED CHRIS ELITE INSIDE OUT!

Eve: CHRIS IS ON THE MAT NOT MOVING AND AHREN SEES HIS CHANCE! HE RUSHES TO THE SIDE AND BEGINS TO CLIMB!

Kassidy Heart (off-mic): YES! BAAAAAA BAAAAAA BAAAAAAAAAAAA! MY BEAUTIFUL GOAT!

Deadprez: CHRIS ELITE IS BARELY STIRRING AS AHREN IS ALMOST HALFWAY UP THE CAGE!

Eve: CHRIS HAS ROLLED OVER NOW AND LOOKS UP TO SEE AHREN CLIMBING! CHRIS TRIES TO POP UP BUT HES HURT! THE CLOTHESLINE FROM HELL DID A NUMBER ON HIM! HE PUSHES HIMSELF UP! HE HAS TO BE RUNNING ON PURE ADRENALINE NOW! CHRIS BEGINS TO CLIMB!

Deadprez: CHRIS NEARLY FALLS OFF FROM THE BROKEN FINGERS BUT HE MANAGES THE KEEP HIS GRIP! BUT AHREN CAN ALMOST REACH THE TOP! CHRIS IS PERCHING HIMSELF ON THE TOP ROPE NOW AND CLUBBING AT THE BACK OF THE CHAMPION! AHREN TRYING TO REACH FOR THAT LAST BAR BUT CHRIS HAS HIM BY THE TIGHTS AS WELL! AHREN TRIES TO KICK AT CHRIS BUT HAVING NO LUCK AS THE CHALLENGER KEEPS POUNDING AT HIM!

Eve: CHRIS LEAPS UP OFF THE TOP ROPE USING THE CAGE AS AN ASSIST FOR AN ENZIGURI TO THE BACK OF AHRENS HEAD! How on earth did he have that left in him?!? AHREN FALLS TO THE MAT AND CHRIS CRASHES DOWN WITH HIM!

Deadprez: Chris gets to his feet quickly as he can, steadying himself on the ropes! Ahren still looks stunned from what just happened but— CHRIS ELITE PULLS AHREN UP INTO THE REAR WAIST LOCK! GERMAN SUPLEX! ROLLS THROUGH AND USES ALL HE HAS TO LIFT AHREN UP INTO THE MODIFIED ELECTRIC CHAIR! ONE WINGED ANGEL! HE COMPLETES THE LONG KISS GOODNIGHT! KEEPS AHREN IN THE SMALL PACKAGE POSITION! NEW CHAMPION!!!!

Ref: ONEEEEEEEEEE!!!!! TWOOOOOOOOOOOOOO!!! THREEEEEEEEEEEEEEEEEEE!!!!!!!!!!!!

Eve: OH MY GOD HOW DID AHREN FOURNIER KICK OUT?!?! HOW DO THESE MEN STILL HAVE ANYTHING LEFT IN THE TANK?!?

Deadprez: CHRIS ELITE CANT BELIEVE IT!! HE HOLDS UP THREE FINGERS TO THE REF! BEGGING FOR THAT TO HAVE BEEN THE THREE COUNT! KASSIDY HEART IS SCREAMING HER HEAD OFF AND BIG MIKE IS APOPLECTIC! THESE TWO WARRIORS GIVING EVERYTHING THEY HAVE FOR THE TOP PRIZE IN THIS INDUSTRY!

Eve: Chris is still stunned and Ahren is trying to crawl himself over to a corner! Trying to create some distance now for a rest! That Kickout must’ve been pure survival instinct! Now Ahren huddled in his own space as Chris presses himself once more to his feet and moves to try to take the fight to the champion! Chris walks over and—

**CRACK**

Deadprez: AHREN WITH THE UMBRELLA ACROSS ELITE’S FACE! THE WHOLE UMBRELLA SEEMED TO BREAK AND WRAP AROUND HIS HEAD WITH THE FORCE OF THAT SWING! CHRIS DROPS FLAT TO THE GROUND BUT AHREN DOESN’T EVEN STOP TO LOOK! HE SAW CHRIS GOING DOWN AND MAKES THE CLIMB AT THE NEAREST POINT! HES USING THE CORNER TO CLIMB QUICKER!

Eve: CHRIS ISNT MOVING! AHREN IS HALFWAY UP! AHREN LOOKS DOWN AND SEES CHRIS STILL ON THE MAT! HE PUSHES ON AND IS TRYING TO GET TO THE TOP! CLIMBING AS QUICK AS HE CAN!

Kassidy Heart (off-mic): SPIDER GOAT! SPIDER GOAT! DOES WHATEVER A SPIDER GOAT DOES!

Deadprez: HES NEARLY TO THE TOP! HE HAS HIS HANDS ON THE FINAL BAR AND LOOKS TO MAKE THE ESCAPE!

Eve: BUT NOW HERE COMES CHRIS ELITE! HES FINALLY GOTTEN HIMSELF BACK UP! HE RUSHES TO THE CORNER AND ON PURE ADRENALINE HE JUST POPPED HIMSELF TO THE TOP ROPE AND SPRINGBOARDED ONTO THE CAGE! HOLY HELL! WHERE DID HE PULL THAT FROM AFTER ALL THIS PUNISHMENT!

Deadprez: CHRIS NEARLY FELL! HAVING TROUBLE STILL WITH THOSE FINGERS BUT THE ADRENALINE HELPS WITH THE PAIN! AHREN IS OVER THE TOP AND TRYING TO GET DOWN BUT NOW CHRIS MAKES IT UP AND GRABS AHREN BY THE ARM!

Eve: CHRIS IS YANKING AND PULLING WITH EVERYTHING HE HAS! KASSIDY HEART IS ON THE OUTSIDE TRYING TO GRAB AHRENS BOOT TO PULL HIM TO THE GROUND BUT HES JUST OUT Of REACH!

Deadprez: CHRIS GETS AHREN UP AND BOTH MEN ARE PERCHED ON THE LEDGE OF THE CAGE! AHREN SLAPS CHRIS ACROSS THE FACE! CHRIS SPITS BLOOD BACK AT AHREN! BOTH MEN PUTTING EVERYTHING ON THE LINE!

Eve: AHREN PUSHES HIS WAY TO HIS FEET! CHRIS PULLS HIMSELF UP BY ONE OF THE CABLES ATTACHED TO THE CAGE! BOTH MEN STARE! AND NOW THE MOVE IN! EXCHANGING LEFTS AND RIGHTS! NEITHER MAN BACKING DOWN! AHREN WITH A RIGHT CROSS TO ELITES JAW! CHRIS WITH A LEFT UPPERCUT TO AHREN! THIS IS A SLUG FEST!

Deadprez: BACK AND FORTH THEY GO AND NEITHER MAN GIVING AN INCH!

Eve: AHREN FOURNIER WITH BACKFIST ACROSS CHRIS’S TEMPLE! CHRIS IS STUNNED! AHREN IS BLINDED BY THE RAGE HERE! HE REARS BACK!

Deadprez: NO!!!!!!!! AHREN JUST HIT A THRUST KICK TO THE CHEST OF CHRIS ELITE!!!!! HE KNOCKED CHRIS OFF THE CAGE AND TO THE OUTSIDE!!!! AHREN YOU IDIOT!!!!!!!!!!

……………………………….

**CRASH**

………………………………..

Deadprez: AHREN YOU GOAT GENIUS!!!!!

Eve: CHRIS LANDED ON THE PILE OF CHAIRS KASSIDY THREW AT BIG MIKE EARLIER! HIS FEET HAVENT TOUCHED THE GROUND BECAUSE IF THE PILE AND HES OUT COLD! AHREN REACHES DOWN TO THE CAGE AND CLIMBS DOWN! HE DROPS DOWN TO THE FLOOR AND FALLS TO HIS KNEES!

(DING! DING! DING!)

(Ahren throws his hands up in the air and Kassidy runs to him in full fangirl mode)

Gina Romano: Here is your winner… AAAAANNNDDDDD STTIIILLLLLL THE EAW CHAMPION….. AHHHRRREEEEEENNNN FFFFOOOOUUUURRRRNNNIIIEEERRRRR!!!!!

(Kassidy is hugging all over Ahren who is completely spent, blood still coating his face. The referee walks over with the championship and Ahren shoves Kassidy off of him to take the title and clutch it to his chest)

Eve: What an amazing match here! These are two of the top competitors in our business that just showed what this title is worth to them!

Deadprez: MAGNUM OPUS REIGNS! IT MAKES ME SMILE TO SEE KASSIDY HEART SMILE!

Eve: Of course it does. Either way, an amazing win here for the champion! The GOAT Champion lives on!

(Ahren and Kassidy gather their things and hand them to the valet boy before having him follow them up the ramp. Big Mike is seen checking in on Chris as medics arrive to examine him)

(Commercial for the Tag Team Deathmatch tomorrow night during Super Bowl halftime. Peanut Butter and Jelly reunited to take on the scourge of Bread and his mistress, Mayonnaise. Seen it all unfold instead of watching some shitty Maroon 5 concert)

Bella Braxton: LADIES AND GENTLEMEN… THE FOLLOWING CONTEST IS A TRIPLE THREAT GRUDGE MATCH AND IT’S SCHEDULED FOR…

Crowd: ONE FALL!!!

(“Ready for War” by Adelita’s Way is the first theme song to start playing. The crowd inside FNB Stadium rise to their feet and start booing. Showdown’s egomaniac Drake King walks onto the stage and shakes his head in disgust.)

Crowd: OK! OK! OK! :troll:

Bella Braxton: INTRODUCING FIRST… FROM BROOKLYN, NEW YORK… WEIGHING IN AT 220 POUNDS… ‘THE KING’ DRAKE KING!!!!

Crowd: OK! OK! OK! :troll:

Rich Russillio: This word is going to haunt Drake King forever.

James Peters: OK. 😀

(Drake covers his ears and shakes his head, but these fans are relentless. They scream OK at Drake the entire time as he makes his way into the ring. Drake walks up the steel ring steps, lets the crowd know EXACTLY how he feels about them, and gets into the ring. He takes his corner and waits for the arrival of his two opponents. “Enemy Strike” by Yuki Hayashi begins to play once Drake’s theme fades out. Myles steps onto the stage and the crowd absolutely erupts for the Australian.)

Bella Braxton: AND HIS OPPONENTS… MAKING HIS WAY TO THE RING FIRST… FROM MELBOURNE, AUSTRALIA… WEIGHING IN AT 208 POUNDS… ‘THE SOLDIER’ MYLES!!!!

Rich Russillio: Listen at the reception Myles is receiving from these fans tonight, James! They absolutely love the fire and passion he brings with him whenever he steps inside the ring!

James Peters: There’s no doubt that Myles is one of the brightest stars on Voltage and he’s just getting his feet wet in this business. There’s nothing but good things in My-

Rich Russillio: HOLY SHIT! XANDER PAYNE JUST CAME FROM BACKSTAGE AND HAS BLASTED MYLES IN THE BACK WITH A CHAIR! XANDER DOES IT AGAIN AND IMMEDIATELY THE REFEREE CALLS FOR THE BELL!!!!

(Ding! Ding! Ding!)

James Peters: THIS MATCH STARTS WITH XANDER ATTACKING MYLES!!! MYLES WASN’T EVEN IN THE RING YET!!!

Rich Russillio: XANDER DROPS THE CHAIR AND NOW HE’S NAILING MYLES WITH THOSE CLUBBING BLOWS TO THE BACK!!! HE GRABS MYLES, THROWING HIM RIGHT INTO THE STEEL RING STEPS!

James Peters: TOPE CON HILO!!!!!!!

Rich Russillio: DRAKE KING COMES FLYING OUT OF THE RING AND TAKES DOWN XANDER PAYNE!!!! DRAKE AND XANDER ARE EXCHANGING RIGHTS AND LEFTS NOW!!! THERE’S NO LOVE LOST BETWEEN THESE TWO RIVALS! IT WAS BACK AT ROAD TO REDEMPTION WHEN DRAKE COST XANDER THE NATIONAL ELITE CHAMPIONSHIP! SINCE THEN, THESE TWO HAVE BEEN A THORN IN ONE ANOTHER’S SIDE… AND MYLES HAS GOTTEN INVOLVED AS WELL!!!!

James Peters: DRAKE AND XANDER ARE BACK UP TO THEIR FEET AND DRAKE LOOKS TO TAKE XANDER DOWN WITH A CLOTHESLINE! XANDER DUCKS AND GRABS ONTO DRAKE! SNAP SUPLEX! DRAKE HITS THE GROUND!!! XANDER GRABS DRAKE BY THE HAIR AND THROWS HIM INTO THE RING!

James Peters: XANDER SLIPS INSIDE, GRABS DRAKE, AND SUPLEXES HIM BACK DOWN! XANDER IS STOMPING A MUDHOLE IN DRAKE NOW! THERE’S SO MUCH HATE BETWEEN THESE TWO MEN! XANDER JERKS DRAKE UP AND THROWS HIM INTO THE CORNER! XANDER PUTTING THE BOOTS TO DRAKE NOW, AND DRAKE FINDS HIMSELF FORCED INTO A SITTING POSITION! XANDER BACKS UP! XANDER COMES RUSHING FORWARD! ROLLING SENTON! XANDER GETS UP, GRABS DRAKE, AND TOSSES HIM TO THE CENTER OF THE RING! XANDER DROPS DOWN FOR THE FIRST COVER!

OOONNNEEE…

Rich Russillio: MYLES IS BACK IN THE RING AND BROKE UP THE COVER! MYLES BEGINS BEATING THE SHIT OUT OF XANDER AND THE FORMER SELF-PROCLAIMED NEW BREED GOD FINDS HIMSELF AT MYLES’ MERCY! THE SOLDIER JERKS UP XANDER AND WHIPS HIM ACROSS THE RING! XANDER DUCKS THE FIRST CLOTHESLINE ATTEMPT, BUT HIS MOMENTUM SENDS HIM RIGHT BACK TOWARDS MYLES! MYLES CATCHES XANDER! HE LIFTS UP THE 2018 BEST BODY AWARD WINNER AND HE TOSSES HIM OVER HIS HEAD!!!!

James Peters: XANDER CRASHES INTO THE ROPES!!! MYLES TURNS HIS ATTENTION TOWARDS DRAKE WHO IS BACK TO HIS FEET BUT STILL IN THE CORNER! MYLES RUNS TOWARDS DRAKE! RUNNING KNEE STRIKE! IT CONNECTS!!! DRAKE DROPS DOWN! MYLES WITH A STIFF KICK TO DRAKE’S FACE! MYLES GRABS DRAKE! HE HOISTS HIM UP! ISSA POWERBOMB! MYLES DOESN’T LET GO THOUGH!!! HE DEADLIFTS DRAKE UP AGAIN! :damn: SPINNING SITOUT POWERBOMB!!! MYLES WITH THE COVER ON DRAKE!!!!

OOONNNEEE…

Rich Russillio: BUT HERE COMES XANDER PAYNE! XANDER JUST CAUGHT MYLES WITH A SUPERKICK STRAIGHT TO THE JAW! MYLES FALLS BACK! XANDER GRABS DRAKE! XANDER TAKES DRAKE AND RUNS HIM SHOULDER FIRST INTO THE RING POST!!! DRAKE GRABS HIS SHOULDER, CLEARLY IN PAIN, AND HE ROLLS OUT OF THE RING! XANDER LOOKS DOWN AT DRAKE AND HE IMMEDIATELY GOES TO THE TOP ROPE! OH MY GOD WHAT IS XANDER PAYNE GOING TO DO?!?!

James Peters: I’LL TELL YOU WHAT HE’S GOING TO DO RICH WHILE WE CONTINUE TO CALL THIS MATCH LIKE WE’RE BOTH EDUCATED VERSIONS OF APOCALYPSE!!! XANDER PAYNE IS ABOUT TO GO HIGH RISK!

Rich Russillio: XANDER PAYNE WITH A MOONSAULT OFF THE TOP ROPE!!!! THAT’S A WHOLE LOT OF MAN THAT JUST FLIPPED HIMSELF OFF THAT ROPE!!!!

James Peters: BUT DRAKE KING MOVES! DRAKE MOVED AND SAVED HIMSELF! XANDER LANDS IN A HEAP ON THE FLOOR AND DRAKE KING RUNS TO THE TIMEKEEPER’S DESK!!! HE’S GRABBING THE RI-

Rich Russillio: NO!!! HE GRABBED A MARKER! THAT’S A FREAKING SHARPIE MARKER!!!!

James Peters: :lupe:!!!!! OH MY GOD! WHAT’S HE GOING TO DO?!

Rich Russillio: DRAKE KING JUST RIPPED THE CLIP OFF THE CAP OF THE SHARPIE AND IS STABBING THE POINT OF IT INTO XANDER’S FOREHEAD! THAT’S CLEVER I GUESS! HE IS DRAGGING THAT LITTLE MAKESHIFT WEAPON ACROSS XANDER’S FOREHEAD AND THE PAYNEKILLER IS NOW BLEEDING!!! NOW DRAKE IS USING THE ENTIRE SHARPIE MARKER TO OPEN THAT WOUND UP EVEN FURTHER!!!!

James Peters: DRAKE KING IS SICK! WHO HONESTLY USES A SHARPIE MARK FOR A WEAPON?! AT LEAST UNCAP THE THING AND LEAK THE INK INTO THAT OPEN WOUND!!!

Rich Russillio: :whoa: DID YOU JUST ENCOURAGE DRAKE TO GIVE XANDER INK POISONING?!

James Peters: …..

Rich Russillio: DRAKE THROWS THE MARKER DOWN AND NOW HE IS GRABBING THE RING BELL!!! DRAKE DOESN’T SEE THAT MYLES IS BACK UP THOUGH! MYLES IS SNEAKING UP BEHIND DRAKE!!!! MYLES IS CLIMBING ON THE RING APRON!!! MYLES LAUNCHES HIMSELF OFF!!!!

James Peters: MYLES FLIES!!!

Rich Russillio: DRAKE TURNS AROUND! HE THROWS THE RING BELL! THE RING BELL SLAMS INTO MYLES’ FACE AND MYLES HITS THE GROUND! DRAKE LAUGHS AND SNATCHES UP THAT BELL!!! HE SLAMS IT RIGHT ACROSS MYLES’ FACE!!! OVER AND OVER THE KING BRINGS THAT BELL DOWN! MYLES IS SURELY BUSTED OPEN NOW! DRAKE HAS TAKEN BOTH OF OUR VOLTAGE STARS TO TASK LIKE THEY’RE RYAN WILSON… THAT SANCTIMONIOUS SACK OF SHIT, AND HE’S NOT DONE YET!!! DRAKE GRABS MYLES AND HE’S WALKING HIM TOWARDS THE REPUBLIC OF THE MARSHALL ISLANDS BROADCAST BOOTH!!!

James Peters: OKAY WAIT! WHY THE HELL DOES ANY COUNTRY THAT MAKES UP MICRONESIA HAVE A BROADCAST BOOTH HERE, LET ALONE ONE THAT IS CONSIDERED THE SEVENTH SMALLEST COUNTRY IN THE WORLD?! I THOUGHT ALL THEY HAD THERE WERE 800 SPECIES OF FISH AND A HISTORY OF SHIPWRECKS?!

Rich Russillio: THE LAST TIME TWO ELITISTS DESTROYED AN OBSCURE COUNTRY’S BROADCAST BOOTH, EAW, OSAMU ARCICHIDA (RIP), AND DARYL KINKADE WERE BANNED FROM LIECHTENSTEIN BECAUSE THEY TOOK OUT THE CROWN PRINCE OF THE COUNTRY!!!!

James Peters: WELL I DON’T KNOW IF THE MARSHALL ISLANDS EVEN HAVE A ROYAL FAMILY BUT DRAKE IS RIPPING THOSE MONITORS OFF THE DESK NOW! HE GOES TO RAM ONE INTO MYLES’ HEAD BUT THANK GOD OUR SOLDIER DUCKS! MYLES WHIRLS AROUND AND HE CATCHES DRAKE WITH A SUPERKICK! DRAKE FALLS BACK! THAT MONITOR SLIPS FROM HIS HANDS!!! MYLES PICKS IT UP AND HE SLAMS IT ACROSS THE BACK OF DRAKE! MYLES GRABS THE CHORD AND WRAPS IT AROUND DRAKE’S NECK AND HE’S NOW CHOKING DRAKE! DRAKE IS GASPING FOR BREATH! DRAKE IS TURNING VARIOUS SHADES OF PURPLE! MYLES KEEPS THAT CHORD WRAPPED AROUND DRAKE’S NECK AND HE SLINGS HIM INTO THE ANNOUNCE TABLE!!!!

Rich Russillio: I CAN HEAR THE ANNOUNCERS FROM THE MARSHALL ISLANDS SCREAMING AT MYLES IN MARSHALLESE!!! THAT MICRONESIAN DIALECT IS THE OFFICIAL LANGUAGE OF THE COUNTRY OF THE MARSHALL ISLANDS BUT HELL IF I KNOW WHAT THE FUCK THEY’RE SAYING!!!!

James Peters: I FIND IT HARD TO FUCKING BELIEVE THAT ANYONE WHO LIVES ON A TINY ASS OBSCURE ISLAND LIKE THAT KNOWS WHAT ELITE ANSWERS WRESTLING IS…

Rich Russillio: OH GOD! XANDER PAYNE IS BACK UP AND NOW HE’S HEADING OVER TO MYLES AND DRAKE! THE FEMALE BROADCASTER FOR THE MARSHALL ISLANDS JUST FAINTED AS THE ESPN BODY ISSUE COVER BOY WALKED TOWARDS HER! MYLES STOPS CHOKING DRAKE AND STANDS UP! HIM AND XANDER LOCK EYES! THEY’RE JAWING BACK AND FORTH WITH ONE ANOTHER! IT’S MYLES WHO THROWS THE FIRST PUNCH! HE CONNECTS WITH XANDER’S JAW! XANDER FIRES BACK WITH A STIFF RIGHT HAND THAT NEARLY TAKES MYLES OFF HIS FEET!!! MYLES REGAINS HIS FOOTING AND HE FIRES BACK WITH A RIGHT HAND! XANDER IS SHOOK! THE TWO MEN LAUNCH THEMSELVES AT ONE ANOTHER AND ARE NOW BRAWLING! IT’S XANDER WITH THE ADVANTAGE! NO IT’S MYLES! MYLES SLAMS HIS FIST INTO XANDER’S FACE!!! BUT XANDER ROLLS THEM OVER AND HE STARTS WAILING AWAY ON MYLES!!!

James Peters: DRAKE KING IS GETTING BACK UP THOUGH!!!! HE’S UNWRAPPED THAT CHORD FROM HIS NECK AND HE’S TAKING A MOMENT TO CATCH HIS BREATH! MYLES AND XANDER ARE STILL FIGHTING! MYLES IS BACK ON TOP NOW! HE’S GOT HIS HANDS WRAPPED AROUND XANDER’S NECK AND HE’S CHOKING THE LIFE OUT OF HIM! XANDER DESPERATELY NEEDS TO USE HIS EXTREME WEIGHT ADVANTAGE TO GET MYLES OFF OF HIM BUT WAIT! HERE’S DRAKE!!

Rich Russillio: DRAKE HAS THAT MONITOR! HE BLASTS MYLES IN THE BACK OF THE HEAD! MYLES CRUMBLES TO THE GROUND!!! DRAKE STANDS OVER XANDER AND RAISES THAT MONITOR ABOVE HIS HEAD!!!!

James Peters: XANDER IS BEGGING DRAKE NOT TO DO IT! HE DOESN’T WANT TO HAVE HIS BRAINS BASHED IN! THIS ENTIRE CROWD IS SCREAMING OK! AND I’M SCARED DRAKE IS GOING TO SNAP AND GO INTO A MURDEROUS RAMPAGE!!! DRAKE IS NEVER GOING TO SHOW XANDER PAYNE ANY SORT OF MERCY AND DRAKE SLAMS THAT MONITOR DOWN!!!!

Rich Russillio: XANDER MOVES!!!!

James Peters: THE MONITOR SLAMS INTO THE GROUND AND SHATTERS!!!! XANDER CLIPS DRAKE IN THE KNEE AND HE GRABS THE LONGEST SHARD OF GLASS FROM THAT BROKEN MONITOR! HE STABS IT IN DRAKE’S ARM!!!! DRAKE HAS GLASS STICKING OUT OF HIS ARM NOW!!! DRAKE GRITS HIS TEETH AND RIPS THE GLASS OUT AND XANDER’S EYES GET WIDE!!! XANDER SCRAMBLES BACK INTO THE RING AND DRAKE FOLLOWS HIM!!! XANDER QUICKLY TRIES TO EXIT ON THE OPPOSITE SIDE!!! DRAKE HAS HIM THOUGH! DRAKE GRABS XANDER BY THE ANKLE AND JERKS HIM TO THE CENTER OF THE RING! XANDER SCRAMBLES BACK UP AND HE AND DRAKE ARE EYE TO EYE NOW! XANDER SLAPS DRAKE ACROSS THE FACE AND DRAKE RESPONDS WITH A STIFF SHOT TO XANDER’S JAW! THE TWO ARE EXCHANGING RIGHTS AND LEFTS!! AND NOW THEY’RE LOCKING UP! BACK AND FORTH DRAKE AND XANDER GO, EACH OF THEM TRYING TO GAIN THE ADVANTAGE!!!

Rich Russillio: DRAKE PRESSES XANDER AGAINST THE ROPES BUT XANDER REVERSES! HE HAS DRAKE AGAINST THE ROPES NOW! DRAKE REVERSES! NOW XANDER! DRAKE AGAIN! XANDER NOW! XANDER GETS DRAKE IN THE ACTUAL CORNER, AND PRESSES HIM AGAINST THE TURNBUCKLES! HE UNLEASHES A HUGE CHOP TO THE CHEST OF DRAKE KING AND THIS AUDIENCE LETS OUT A GASP! DRAKE SHOVES THE FORMER NEW BREED CHAMPION AWAY FROM HIM AND LETS GO WITH A CHOP OF HIS OWN! XANDER SHAKES IT OFF! FIRES BACK! AND HERE WE GO! IT’S A FREAKING CHOP FEST!

James Peters: THIS CROWD IS ON THEIR FEET, ABSOLUTELY EATING THIS UP! DRAKE AND XANDER! XANDER AND DRAKE! DRAKE UNLEASHES ONE FINAL CHOP!!! NO!!! OH MY GOD! HE CHOPPED XANDER IN THE FACE! XANDER PAYNE HITS THE MAT AND DRAKE KING BACKS UP!!! IT’S THE CURB STOMP!!!

Rich Russillio: XANDER MOVED OUT OF THE WAY!!! DRAKE HAS TO STOP HIS OWN MOMENTUM AND HE TURNS AROUND! XANDER IS BACK TO HIS FEET AND HE CATCHES DRAKE WITH A DISCUS PALM STRIKE!!! DRAKE IS BLEEDING FROM THE NOSE NOW WHICH IS FITTING SINCE XANDER HAS DUBBED THAT MOVE ‘BLOODY NOSE’ AND XANDER THROWS DRAKE BACK OUT OF THE RING!

James Peters: MYLES IS FINALLY BACK TO HIS FEET AFTER BEING TAKEN OUT BY THAT MONITOR AND XANDER SEES THAT! HE GETS A RUNNING START AND FLIES TOWARDS MYLES!!! MYLES SIDE STEPS HIM AND XANDER’S MOMENTUM SENDS HIM CRASHING INTO THE MARSHALL ISLANDS ANNOUNCE BOOTH!!! HE TAKES OUT BOTH BROADCASTERS INCLUDING THE ONE WHO FAINTED OVER HIS GODLINESS EARLIER!!! MYLES GRABS XANDER AND PULLS HIM ON TOP OF THE TABLE!!! WHAT IS MYLES GOING TO DO!!! MYLES USES ALL HIS STRENGTH TO HOIST XANDER UP IN THE AIR!!! DE FACTO! DE FACTO!!

Rich Russillio: THEY JUST BROKE THAT BROADCAST TABLE!!!

James Peters: DRAKE KING SEES WHAT’S HAPPENED AND HE HEADS OVER TO THE CARNAGE! DRAKE GRABS MYLES BY THE HAIR AND TOSSES HIM INTO THE RING APRON! MYLES BACK BOUNCES OFF THE APRON AND DRAKE LAYS HIM OUT WITH A RUNNING KNEE TO THE FACE!!! DRAKE NOW GRABS XANDER!!! DRAKE SMELLS THE VICTORY AND HE THROWS XANDER BACK INTO THE RING! DRAKE FOLLOWS HIM INSIDE AND HE STANDS OVER XANDER!!! DRAKE DROPS DOWN AND HE WRAPS XANDER PAYNE UP IN THE RINGS OF SATURN! OH MY GOD! XANDER PAYNE IS GOING TO TAP OUT! XANDER IS GOING TO TAP OUT! DRAKE KING IS ABOUT TO GET THIS VICTORY!!!!

Rich Russillio: BUT MYLES IS UP! MYLES IS SLIPPING BACK INTO THE RING!!! MYLES FROM BEHIND!!! DRAKE KING TAKES THAT SHOOT STYLE KICK FROM MYLES RIGHT TO THE BACK OF THE HEAD! THE SUBMISSION IS RELEASED! BUT MYLES GRABS XANDER!!! XANDER IS HOISTED IN THE AIR!!! ANOTHER DE FACTO!!! MYLES GOES FOR THE COVER!!!!

OOONNNEEE!!!

TTTTWWWWOOOO!!!!

TTTTTHHHHHRRRRREEEEEEEEEE!!!!!

James Peters: DRAKE SOMEHOW DIGS DEEP AND BREAKS IT UP!

Rich Russillio: MYLES GETS TO HIS FEET AND HE PULLS DRAKE UP! NOW THESE TWO ARE GOING AT IT VERBALLY! MYLES WITH A RIGHT HAND! DRAKE FIRES BACK WITH AN UPPERCUT!! MYLES WITH A KICK TO DRAKE’S SIDE!!! DRAKE WITH A CHOP!!!!! DRAKE WITH ANOTHER CHOP!!!!! HE’S LIGHTING MYLES UP!!! BUT MYLES CATCHES HIM WITH A KICK TO THE SHIN!!! AND ANOTHER!!! AND ANOTHER!!! MYLES GRABS DRAKE!!! HE SLAMS HIS KNEE INTO DRAKE’S FACE!!! DRAKE PROBABLY HAS A BROKEN NOSE AFTER THIS MATCH TONIGHT!!!! MYLES CATCHES DRAKE WITH AN ENZIGURI AND HE MANAGES TO GET THE KING UP!!! CANADIAN RACK INTO A DDT!!! MYLES GOES FOR THE COVER!!!!

OOONNNEEE!!!

TTTTWWWWOOOO!!!!

TTTTTHHHHHRRRRREEEEEEEEEE!!!!!

James Peters: XANDER PAYNE BREAKS IT UP!!!! XANDER THROWS MYLES TO THE SIDE AND NOW HE TRIES TO COVER DRAKE!!! MYLES GETS BACK UP AND HE DROP KICKS XANDER! MYLES GRABS DRAKE AND HE THROWS HIM SHOULDER FIRST INTO THAT RING POST! THAT’S THE SAME SHOULDER DRAKE WAS FAVORING EARLIER!!! MYLES LIGHTS XANDER UP WITH THOSE PERFECTLY PLACED KICKS! THERE’S NOT A LOT XANDER CAN DO!!! MYLES CATCHES XANDER IN THE TEMPLE AND HE PICKS HIM UP!!!

Rich Russillio: CANADIAN RACK INTO A DDT AGAIN!!!!

James Peters: MYLES WITH THE CO-

Rich Russillio: NO! MYLES PICKS UP XANDER AGAIN!!!! ANOTHER DE FACTO!!!! MYLES TURNS AROUND AND SEES DRAKE ABOUT TO RUSH OVER!!! MYLES RUNS TO DRAKE AND CLOTHESLINES HIM OVER THE TOP ROPE!!!! MYLES GOES BACK TO XANDER AND GOES FOR THE COVER!!!!

OOONNNEEE!!!

TTTTWWWWOOOO!!!!

TTTTTHHHHHRRRRREEEEEEEEEEEEEEEE!!!!!!!!!!!

(Ding! Ding! Ding!)

Bella Braxton: LADIES AND GENTLEMEN… HERE IS YOUR WINNER… MMMMYYYYYYLLLLLLEEEEEEESSSSSSSSSS!!!!

(The crowd erupts as Myles’ theme music begins to blast across the public address system. Myles stands up, completely elated he managed to win this grudge match, and prove to the world that he does belong in Elite Answers Wrestling. On the outside of the ring, Drake King looks pissed.)

James Peters: WHAT AN INCREDIBLE WIN FOR THE SOLDIER MYLES HERE TONIGHT!!!

Rich Russillio: THIS KID IS THE REAL DEAL, JAMES!!! THERE’S NO DOUBT IN MY MIND THAT MYLES IS GOING TO HOLD CHAMPIONSHIP GOLD HERE IN EAW!!!!

James Peters: I TAKE NOTHING AWAY FROM DRAKE KING AND XANDER PAYNE! THEY ARE THE FUTURE OF THIS COMPANY AS WELL. DRAKE KING CAN ALREADY SAY HE’S RETIRED A HALL OF FAMER AND COMPETED FOR MULTIPLE CHAMPIONSHIPS!!! XANDER HAS HELD GOLD BEFORE AND WAS WELL ON HIS WAY TO SECURING HIS TITLE IN A YEAR BACK AT ROAD TO REDEMPTION! IT’S ONLY A MATTER OF TIME BEFORE THE PAYNEKILLER FINDS HIMSELF WITH ANOTHER TITLE TO HIS NAME!!!

Rich Russillio: THIS MATCH WAS EVERYTHING… AND WOW. I’M GETTING WORD THROUGH MY HEADSET THAT EAW IS INDEED NOT WELCOME ON THE REPUBLIC OF THE MARSHALL ISLANDS. APPARENTLY THE FEMALE BROADCASTER WHO FAINTED AND WAS TAKEN OUT DURING THE MATCH IS SOME KIND OF RELATIVE OF THE HEAD OF FOREIGN AFFAIRS FOR THE MARSHALL ISLANDS. NOT SURE HOW DEEP THAT GOES BUT APPARENTLY THEY HATE US NOW.

James Peters: THAT’S TWO COUNTRIES WE’RE BANNED FROM NOW. TWO!!!!

Rich Russillio: OH WELL! THE FACT REMAINS THAT DRAKE KING, XANDER PAYNE, AND OUR VICTOR MYLES SHOWED UP AND SHOWED OUT THIS WEEK! THEY PROVED THAT THEY’RE NOT SOME ASSHOLE’S PISS BREAK MATCH.

James Peters: RYAN WILSON WISHES HE COULD!!!!

Rich Russillio: WE STAN OUR THREE FUTURE PAIN FOR PRIDE MAIN EVENTERS!!!! 😀 :wow:

(The cameras cut to Drake King, who is seen angrily punching the ring steps. Myles is in the ring celebrating his victory. King of Elite fades to a quick break promoting Empire’s upcoming Iconic Cup tournament.)

Maria Del Rey: The following contest scheduled for one fall is a CHAIN MATCH……

Crowd: AJDFLAHLFKFLAKJALHJHFAJK FLAKAFLHFOIPIFGHSUHIGSUIHMJLHMUFOPSMHG

Maria Del Rey: And it’s for the ELITE ANSWERS WRESTLING SPECIALIST CHAMPIONSHIP!!!

(“Surfin’ (ft. Pharrell Williams)” by Kid Cudi begins to play as Serena comes out to the stage, smiling wide and showing off her jewelry. She skips down the ramp with supreme confidence, not really engaging with the fans as she receives a mixed reaction. Upon entry to the ring, she jumps onto the middle turnbuckle to pose before jumping down and hopping in place in the corner.)

CJ Hanna: And yet another title up for grabs here at King Of Elite, this one being Empire’s own Specialist Championship! Out first we have the challenger, Serena Bennett, who first made her big debut splash at Road To Redemption by outlasting four other women to include the former champion, Tyler Wolfe, and she’s been making big waves each week since!

Gavin: Yeah, but she’s been a complete bitch to my flawless goat, Andrea Valentine! Who she think she is with all this disrespect toward my second favorite wrestler in the whole world!

CJ Hana: Who’s your first?

Gavin: Really??? Only the Queen Of The Nile!! DUHHH!!!

(CJ rolls her eyes)

(‘Roll With Me’ by Charli XCX. begins to play as the crowd erupts with roaring cheers of approval for the current Specialist’s Champion, Andrea Valentine. Andrea walks out to the top of the ramp with the Specialist’s Title belt on her left shoulder. She holds it up high which elicits even more deafening roars of approval from the crowd as she then makes her way down the ramp toward the ring.)

CJ Hanna: The Specialist’s Champion has arrived and this crowd in Johannesburg are going absolutely berserk for Andrea Valentine! She looks ready to go to war, Gavin!

Gavin: She looks ready alright! Where’s her stunt double, though, so she can come sit here on the lap of ole daddy Gavin?? HEY ANDREA! HI!! I’M RIGHT HERE!! I THINK SHE’S ACTUALLY WAVING AT ME! RIGHT HERE ANDREA!!

Maria Del Rey: In the corner to my right, she is the CHALLENGER….She hails from Compton, California….She weighs in at ONE HUNDRED AND FOURTEEN POUNDS….SEEERRRREEEENNNNAAAA BEEENNNNNEEETTTTTTTTT!!!!

(The challenger, Serena Bennett, steps forward extending her arms up and outward with nothing but supreme confidence as she stares in to the eyes of the Champion, Andrea Valentine.)

Maria Del Rey: And in the corner to my left, she is the CHAMPION….She hails from Orlando, Florida….She weights in at ONE HUNDRED AND TEN POUNDS….SHE’S THE HEART OF EMPIRE….THE ELITE ANSWERS WRESTLING SPECIALIST CHAMPION….ANNNNDDDDDDREEEEEAAAAA VAAAALLLLLEEEENNNNNTTTTIIIINNNNNEEEE!!!!

(The champion, Andrea Valentine, steps forward holding her title belt up high as she now stands just mere inches from being nose to nose with her challenger, Serena Bennett. Serena looks up at the title belt for a split second as Andrea Valentine is already talking to her before both ladies take a step back and the referee steps between them with the chain in hand that both ladies will be wearing on their wrist per stipulation. Prior to placing the chain on both ladies the referee holds up the Specialist Championship from center ring before walking over to the ropes and handing it off to a ringside crew member. The referee then goes to the champion, Andrea Valentine, first and begins running through the rules of the match as he’s looping the wrist strap around the wrist of Andrea until he has it tied perfectly around her wrist, Andrea concurs, nodding her head.

(DING! DING! DING!)

CJ Hana: Both ladies starting out a bit cautiously here, that twelve feet of chain is about as far as they will get in separation on this night, Gavin. This won’t be a bout for the weak of heart! Both still being cautious in their pursuit of the other! A sly smile just came over Serena Bennett! Andrea Valentine readies herself as Serena moves in looking to attack with a clothesline! But it’s ducked by Andrea Valentine! Serena Bennett hurries to recover from her mistimed clothesline attempt! Now both move in for the traditional collar and elbow tie up and it’s the current champion Andrea Valentine that assumes the advantage with a quick headlock takedown of the challenger, Serena Bennett! Serena Bennett though grabs Andrea Valentine in a waist lock from the grounded position and uses her upper body strength to roll Andrea on to her back where both of her shoulders are touching the canvas! The referee right there to see it!

Referee: ONE!!!!…..TWO!!!!!……KICKOUT!!!

Gavin: That was a decent position from this distance that Andrea showed us! Here full ass was almost showing during a sequence! Oh well, still plenty of time to get a good shot, I suppose! Both taking their sweet ass time again to hug each other! Serena begins grabbing some of the chain now! She’s pulling sexy Andrea Valentine to her! Now Andrea Valentine gives some resistance to this and begins pulling some slack of her own! It’s a tug of war! All we’re missing now are bikinis and a mud pit! HAHAHAHA!!! And it seems Serena has grabbed the slight advantage in it as she pulls our dear Andrea closer to her! I think this is it! They’re gonna do it! They’re gonna make love babay!! YESSSS!!!! NOOOO!!!! WTF??? Serena just sucker punched Andrea’s beautiful flawless face!! At least it wasn’t with that chain, but still! Cheap shots should not be condoned when you have facial features as flawless as Andrea’s! Serena smells blood now and she picks up a wad of chain from the canvas and charges for Andrea with that wad of chain! she looks to send a shot at Andrea’s face again! BUT ANDREA CATCHES SERENA WITH A KICK TO THE MIDSECTION THAT STOPS HER COLD IN HER TRACKS! YES!!! ANDREA VALENTINE QUICKLY REBOUNDS OFF THE ROPES AND SHE DOWNS SERENA WITH A BICYCLE KICK!!! Serena is down but she’s now on all fours trying to recover! WHOA! WHOA! WHAT IS ANDREA VALENTINE DOING!!!???

CJ Hana: She’s wrapping the loose slack from that chain around the front of her boot! OH MY!! ANDREA RAISES THAT BOOT UP! AND DOWN IT COMES!!

Serena: AHHHHHHHHHHHHHHHHH!!!

CJ Hana: SERENA BENNETT SCREAMING OUT IN PAIN!! ANDREA VALENTINE JUST BROUGHT HER BOOT WRAPPED WITH CHAIN DOWN WITH SO MUCH FORCE ON THE BARE AND FREE HAND OF SERENA BENNETT!!! SERENA ROLLING AWAY CONTORTING HER BODY!!! ANDREA VALENTINE STALKING SERENA NOW!! SERENA BENNETT SHE CAN’T EVEN PUT ANY WEIGHT ON THAT HAND AS SHE TRIES TO RISE!! ANDREA GRABS UP A WAD OF CHAIN AND NOW COMES RIGHT FOR SERENA WITH NO REMORSE IN HER EXPRESSION!! BACK KICK CONNECTS WITH THE MIDSECTION ANDREA!! SERENA BENNETT STILL FAVORING THAT RIGHT HAND THAT WAS STOMPED MERCILESSLY BUT HERE SHE COMES! SERENA BENNETT LUNGES RIGHT AT ANDREA VALENTINE! THEY’RE BOTH ON THE GROUND NOW!! SERENA BENNETT GRABS THE HAIR OF ANDREA VALENTINE AND SLAMS HER HEAD INTO THE CANVAS OVER AND OVER AND OVER!!! THE CHAMPION USES HER STRENGTH TO ROLL SERENA BENNETT TO HER BACK NOW!! ANDREA VALENTINE IS NOW SLAMMING SERENA’S HEAD TO THE CANVAS A COUPLE OF TIMES!! THE CROWD INTO IT!! SERENA NOW REVERSES THE MOMENTUM! NOW ANDREA REVERSES IT!! BOTH LADIES NOW ROLLING UNDER THE BOTTOM ROPE AND DROPPING TO THE FLOOR!! THERE’S NOTHING THE REFEREE CAN DO AT THIS POINT!! ALL THE REFEREE CAN DO IS ADMONISH THESE LADIES BUT HE CANNOT DICTATE THE WAY THIS MATCH IS GOING TO GO!!

Gavin: Serena is the first one back to her feet, COME ON ANDREA, SHAKE THE COBWEBS BABE!! Damn watch the hair! She yanks Andrea Valentine up by her hair and takes her over to where the barricade is BUT YES!!! ANDREA FIGHTING BACK NOW WITH THOSE HARD RIGHTS!! NOW SERENA THROWING CLOSED FIST RIGHTS BACK AT ANDREA!! YES!! CAT FIGHT! I LOVE IT!! CLOTHESLINE BY SERENA BENNETT FLOORS ANDREA VALENTINE!!! DAMN!

CJ Hana: NOW SERENA BENNETT WRAPPING THAT CHAIN AROUND HER KNUCKLES!! SERENA BENNETT NOW DOWN ON A KNEE AND BEGINS PUMMELING THE HOLY HIGH HELL OUT OF ANDREA VALENTINE’S HEAD!! BLOOD STARTS STREAMING DOWN THE SIDE OF ANDREA’S FACE!! SERENA BENNETT RELENTS FOR NOW BUT THE DAMAGE HAS BEEN DONE!! Oh my. Andrea is trying to stand, but Serena right there. She grabs Andrea by the back of her head and runs her in face first into the ring post. Andrea Valentine falls to her side now as Serena now stalks Andrea! Now Serena reaches under the ring and pulls out a steel chair as Andrea Valentine is trying to recover, trying to use the ring apron to pull herself up and Serena is now back to her feet as Andrea turns around. Andrea though doesn’t give Serena time to react as she runs at Serena and lands a running dropkick of the chair right into the face of Serena Bennett! Serena falls back but Andrea is back to her feet and now yanks at the chain enough to force Serena back up to her feet only to watch her fall back down! Andrea bloody and all grabs Serena up as Serena continues to try and shake it off!

Gavin: My beautiful Andrea! What have you done to her Serena you bitch!!?? Andrea Valentine rolls the dizzy Serena Bennett into the ring! Andrea slides in, but ugh, that face! Like a car ran it over! SHEEESH! Andrea picks Serena up and brings her to the corner where she begins to deliver devastatingly hard knife edged chops to the chest of the helpless Serena Bennett! AND SERENA IS SCREAMING LIKE A LITTLE BITCH AND I’VE NEVER SEEN ANYTHING COOLER IN A HOT MINUTE!! FOX DOES CARE ANDREA!! MAKE HER FEEL EVERY ONE OF THOSE!

CJ Hana: Serena falls to her knees! VALENTINES MASSACRE OUT OF THE CORNER BY ANDREA VALENTINE!!! ANDREA JUST TOOK SERENA BENNETT DOWN TO THE CANVAS HEAD FIRST AND SERENA IS OUT OF IT!! WOW!! ANDREA FALLS INTO A COVER!

Referee: ONE!…..TWO!…….KICKOUT!!!….

Gavin: WAY NOT COOL! DAMN YOU SERENA! YOU NEVER COULD KNOW YOUR DAMN ROLE! THAT’S WHY YOU DON’T WORK FOR FOX ANYMORE! NOW YOU JUST ANOTHER ONE OF FOX’S LITTLE PUPPETS! HOW YOU LIKE THEM APPLES!!?? At any rate, Serena Bennett is a big coward. Look at her as she crawls on all fours trying to flee from Andrea! Oh come on! Andrea you should know better! Saw that drop toe hold coming from miles away! Ah, now see. This is not even worth my time to commentate…CJ????

CJ Hana: Serena Bennett just tripped up Andrea Valentine and has grabbed the back of Andrea’s head and has begun slamming her face first into the canvas staining it with Andrea’s blood! This is not good at all! Serena now twisting the left leg of Andrea Valentine, stretching and twisting it in places it shouldn’t be as she locks in that Indian Deathlock! She calls it Serenity!! How appropriate! Andrea Valentine screaming out in pain as she tries desperately to throw fists at the head of Serena Bennett but Serena just sits back a bit to avoid the contact! Andrea Valentine’s calf and thigh muscles have got to be burning on fire! That expression says it all as she writhes in pain! Will Andrea Valentine submit!!?? Is this the end of her Specialist Championship reign!!?? She fought so hard to earn herself another title here in Elite Answer’s Wrestling after her initial run as the Openweight Champion ended abruptly! She made the World proud back at Road To Redemption, can she do it again!!??

Gavin: Andrea better try something else quick before this pain becomes too unbearable! The referee right there to check with Andrea Valentine to see if she wants to quit! But she simply shakes her head ‘no’ as she continues to scream out in agony! Her face is turning red from the pain! Andrea though is slowly rising back up through that pain and looks into the eyes of Serena! Certainly not passionately as I was thinking about in that dream I had the other night under the covers but it’s a look of some sort of defiance, I guess! She’s twisting her body slightly in the direction of the chain! She screams out again but grabs a lot of slack from that chain and wraps it around her knuckles and she begins using it to the the exposed kneecap of Serena Bennett over and over! Yes!!! Good thinking Andrea! NOW THE OTHER ONE!! BREAK HER KNEECAPS!! NOW IT’S SERENA TRYING TO ESCAPE HER OWN MOVE THAT SHE HAS THE ADVANTAGE OF!! WHO COULD EVER SAY THEY SAW THAT COMING!??

CJ Hana: Serena Bennett has unlocked the Serenity move! Andrea Valentine has successfully broken that Indian Deathlock! But you can clearly see both ladies don’t have the leg strength to even rise back to their feet at the moment for entirely different reasons! Both ladies crawling away from the other, but they don’t get far with that twelve feet of chain that doesn’t allow them to separate from each other any further! Both begins trying to tug the other in the opposite direction! Both are trying to reach the ropes but with each tug back and forth at the moment that’s not possible! You can see as Serena tries desperately to reach out for those ropes how swollen and bruised her right hand is from Andrea stomping on it with that chain wrapped around her boot! Both of these ladies have absolutely pummeled the crap out of each other in any which way that they can think of! And now neither one is able to even get up to a standing vertical base!

Gavin: Oh, Andrea, you’re beautiful face! Fox will make you flawless again! We promise! Andrea is definitely tougher though! Look at her as she rises back up through the pain that must be coursing through her lower half of that sexy body! We’ll work around the bloody horror movie like look of a face as I just stated but Serena Bennett, she’s completely S.O.L. since Andrea busted up her kneecaps real good! Serena crying in pain as turns and sits up holding her knees! She is now begging Andrea Valentine off but Andrea just looks at her and shakes her head ‘no’ telling Serena I will not sleep with you tonight or any night for that matter! That Gavin Kirkland is mine!

CJ Hana: Uhhhh….I highly doubt that, Gavin! She’s certainly uttering something to Serena as she begins pulling at the chain once more and Serena shakes her head as she frantically looks on telling Andrea ‘no’ but Andrea Valentine keeps pulling on it! Look at this she’s actually forcing Serena Bennett to her feet! Serena yells out in pain as she puts all her weight on those weak knees! But she’s up to a vertical base now along with Andrea! Andrea Valentine slowly walks up to Serena who’s still in pain but just stands her ground!

Andrea (off mic): I’ll never give someone like you the satisfaction of taking what I’ve worked hard for away from me! This isn’t your night, Serena! I’m putting your coming out party on hold.

Gavin: That’s right, ladies! Fight over me! I’ll be waiting! THERE WE GO! SERENA AND ANDREA DUKING IT OUT BACK AND FORTH WITH THOSE CLOSED FIST RIGHTS!! DON’T GO DOWN ANDREA! YEAH! SERENA YOU DUMB TWAT! THAT’S RIGHT! KEEP PUNCHING WITH HER! THAT SURE WORKED IN ROCKY DIDN’T IT!!?? HAHAHA!! AND YES ANDREA HAS CONTROL AS SHE WHIPS SERENA TO THE ROPES!! HIPTOSS BY ANDREA VALENTINE!! ANDREA GRABBING THAT CHAIN!! WHOHOHOHOOOOO!!! YEAH CHOKE HER OUT AGAIN JUST LIKE YOU DID A MONTH AGO!! SHOW HER WHO THE REAL BOSS IS ANDREA!

CJ Hana: INDEED ANDREA VALENTINE SECURED THE VICTORY AND THE SPECIALIST CHAMPIONSHIP COURTESY OF SERENA BENNETT’S LOG CHAIN SHE BROUGHT TO ROAD TO REDEMPTION! BUT SERENA FIGHTING IT!! SHE WON’T LET ANDREA GET IT OVER HEAD AND AROUND HER NECK!! SERENA BENNETT PULLS AT THE HAIR OF ANDREA VALENTINE! AND A SNAPMARE BY SERENA BENNETT THAT TAKES ANDREA VALENTINE DOWN TO THE CANVAS! SERENA SWINGS AROUND AND BACK TO HER FEET SO QUICKLY! AND NOW SHE’S APPLYING THAT CHAIN! SHE’S WRAPPED IT AROUND THE NECK OF ANDREA VALENTINE! ANDREA STRUGGLING! BUT WAIT ANDREA COUNTERS THIS WITH BLIND LUCK! SHE REACHED FROM BEHIND AND GRABS THE CHAIN PULLING IT IN AS SHE DOES! SERENA BENNETT ISN’T EXACTLY A HEAVYWEIGHT BUT THIS IS AMAZING NO LESS! ANDREA HAS SERENA BENNETT OFF HER FEET!! SERENA CAN’T BELIEVE IT! ANDREA HAS SERENA ON HER SHOULDERS!! AND A SAMOAN DROP! NO!! SERENA FIGHTS OUT OF ANDREA’S GRIP AND LANDS ON HER FEET! SERENA RUNS RIGHT AT ANDREA! XOXO!!! THE INVERTED STOMP FACEBREAKER!!! ANDREA SCRAMBLES TO HOOK THE LEG FOR THE COVER!! THE REFEREE IN PERFECT POSITION!!

Referee: ONE!!!……..TWO!!!!……..THRE-…….KICKOUT!!!

Gavin: Damn! She almost had her! Andrea hurries back to her feet! She’s a little annoyed at the impudence of this backstabbing blasphemes traitor who tried to give Fox a bad name! Andrea whips Serena to the corner but Serena reverses it and sends Andrea to the corner! Crap! Serena don’t mess up her face anymore! Please! Serena don’t you do it! Oh man! That’s even worse! A monkey flip sends Andrea clear overhead where she lands on that beautiful tush! Andrea holds her back in pain, and I think even I feel that! Oh come on Andrea, please bring your double out! I already love ya for trying, but let’s not make things worse!

CJ Hana: SERENA BENNETT ON THE ATTACK AGAIN!! WITH THE SHITS!!! SHOOT KICKS TO ANDREA VALENTINE AS SHE WAS GETTING BACK TO HER FEET! BACK KICK SENDS HER TO THE NEARBY ROPES! SERENA YANKS HER BACK THOUGH WITH THAT CHAIN RIGHT TO HER!! MOONLIGHT!! THE RUNNING NECK BREAKER BY SERENA BENNETT THAT TAKES ANDREA DOWN! ANDREA TRIES TO RECOVER QUICKLY BUT SERENA BENNETT WITH YET ANOTHER MOONLIGHT TO THE REIGNING SPECIALISTS CHAMPION!! SERENA GRABS UP ANDREA WITH FORCE! BUT A SPINNING BACK FIST TO THE FACE OF SERENA BENNETT THAT STAGGERS HER! LOVE HAZE!!! RUNNING CORKSCREW NECKBREAKER!! THAT’S IT!!! IT’S OVER!!! ANDREA DIVES INTO A COVER ON SERENA!

Referee: ONNNNEEEE!!!…..TWWWWOOOO!!!……THRRRREE-….

Gavin: NOOOOOOOOOOO!!!! DAMMIT!! WILL THESE PEOPLE SHUT UP!!??? SERENA GETS HER SHOULDERS OFF THE CANVAS JUST IN TIME AND NOW SHE’S TRANSITIONED RIGHT INTO THE TRAP QUEEN!!! SHE’S GOT ANDREA TRAPPED IN THE MODIFIED TRIANGLE CHOKE HOLD!! HER FINISHER! NOOOOOOO!!!! DON’T TAP ANDREA!! I LOVE YOU!! DON’T TAP IN THE NAME OF LOVE!!!

CJ Hana: Andrea Valentine may be seeing her reign as Specialist Champion end right here! She’s at a huge disadvantage! BUT WAIT A MINUTE! LOOK AT THE FLEXIBILITY OF ANDREA VALENTINE! WITH THOSE LONG LEGS SHE MANAGES TO REACH HER LEGS OVER THE HEAD OF SERENA AND USES HER LEG TO PUT HER IN A REVERSE DOUBLE LEG TRIANGLE CHOKE!! MY GOD!! NOW ALL THE PRESSURE IS ON SERENA BENNETT!! SERENA TRYING TO PRY THE UPPER LEG OF ANDREA VALENTINE OFF! SERENA THOUGH-OH MY!! SHE HAD THAT CHAIN! SHE JUST CLOCKED ANDREA VALENTINE UPSIDE THE HEAD!! ANDREA VALENTINE IS OUT!! Serena Bennett slides out from the leg choke of the unconscious Andrea Valentine! It’s pretty academic from here as Serena goes for the cover!

Referee: ONNNNEEEEE!!!……TWWWOOOOOO!!!……..THHRRREEEEEE-……

Gavin: YESSS!!!! SHE’S ALIVE! SHE’S ALIVE!! MY ANDREA KICKED OUT!! SERENA BENNETT IS BESIDE HERSELF!!!! I’M NOT SURPRISED IN THE LEAST!! SERENA NOW BITCHING TO THE REFEREE!! MY ANDREA FROM BEHIND WITH THE SCHOOL BOY PIN!!!

Referee: ONE!!!…..TWO!!!…..KICKOUT!!

CJ Hana: Serena quickly kicks out but Andrea Valentine right back up on the attack! BUT WITH THE SHITS!! THOSE SHOOT KICKS OF SERENA BENNETT STOPS THE MOMENTUM OF ANDREA! SERENA CLIMBS UP THE TURNBUCKLE AND SHE GET’S READY TO FLY!! BUT ANDREA RIGHT THERE TO MAKE SERENA LOSE HER BALANCE AND NOW SHE’S A SITTING DUCK ON THE TOP TURNBUCKLE!! ANDREA HAD TOO MUCH TIME TO REACT!! ANDREA HAS ROLLED UP SOME OF THAT CHAIN ON HER KNUCKLES AND NOW ONE SHOT! TWO SHOTS! RIGHT TO THE HEAD OF SERENA BENNETT WHICH KNOCKED HER HEAD, SCRAMBLED HER BRAINS PERHAPS!! SHE’S DAZED! ANDREA CLIMBS UP AND READIES FOR!! SHE DELIVERS!!! SUPERPLEX OFF THE TOP!! BOTH LADIES ARE DOWN NOW!! The fans are on their feet trying to urge both ladies up here! Both are slowly coming to and trying rise up! Now both ladies using the other for support to stand! A right from Andrea! A left from Serena! Another right from Andrea! Serena tries for the shoot kick but misses!

Gavin: YES!!! ATOMIC BLONDE!! NOOOOOOOOOOO!!! WHAT LOW DOWN DIRTY TRICK! ANDREA LANDS ON HER HEAD AWKWARDLY AS THE BLOTCHED ATOMIC BLONDE! THAT REVERSE FRANKENSTIENER WAS JUST BLOCKED BECAUSE SERENA GRABBED THE ROPES!! ANDREA HOLDING HER HEAD AND NECK ON THE CANVAS! DAMN! NOW SERENA IS CHEATING AGAIN BY APPLYING THE TRAP QUEEN!! ANDREA IS INJURED NOW!! SO UNFAIR! THAT ARM TRAP TRIANGLE CHOKE HOLD HAS BEEN REAPPLIED! NO! NO! NO! NO! NO!

CJ Hana: ANDREA TRYING MANEUVER HER LEGS OVER AGAIN LIKE SHE DID THE FIRST TIME SHE WAS TRAPPED IN THIS MOVE! NOW SERENA MODIFIES THE MOVE BY RE-POSITIONING HERSELF TO WHERE ANDREA CAN’T WRAP THOSE LEGS AROUND SERENA’S HEAD!! ANDREA IS TRYING TO MOVE BUT SERENA NOT GIVING HER ANY GROUND THIS TIME! SERENA TIGHTENS THE HOLD AND WRENCHES BACK EVEN FURTHER NOW!!…………AND ANDREA VALENTINE TAPS!!! IT’S OVER! AND WE NOW HAVE A NEW SPECIALIST CHAMPION!

(DING! DING! DING!)

( “Surfin’ (ft. Pharrell Williams)” by Kid Cudi starts up again as Serena Bennett rolls away from Andrea Valentine! The bloodshed is still evident from the war she just looks up at the lights as the referee holds her arm up awarding her the match.)

Maria Del Rey: The winner of this match by submission……ANNNNNDDDDD NEEEEWWWWWWW ELITE ANSWERS WRESTLING SPECIALIST CHAMPION……SEEEEERRRRREEEEENNNNNAAAA BENNNNNNETTT!!!

CJ Hana: What a war we just witnessed, Gavin. Both ladies laid it all on the line! It was a back and forth brawl pretty much from the start! This was no wrestling match to test athleticism, but we were still treated to an absolutely over-the-top great match!

Gavin: No comment……….

(The shot shows Gavin with his head down, appearing to be crying! Andrea Valentine, having finally gotten the chain removed, getting helped up with support of the ropes as well as the referee. Serena Bennett is still shown holding her head in a great deal of pain. Serena now having left the ring looks back at Andrea from a standing position, and then she holds up the Specialist Championship. She holds up her newly won title for a brief moment given that the adrenaline having started to wear off now has her weakened and limping toward the ropes before slowly making her way through them to the floor. She begins limping up the ramp as Andrea Valentine is sitting up finally just shaking her head with a disappointed and disgusted look on her face, and then the shot goes back to Serena who’s still on her way up the ramp! Serena holds up the the Specialist Championship once more, smiling proud of herself. Then she looks back at her opponent this on the ramp as the scene goes elsewhere.)

( Camera opens back up to Stephie Love who is in the ring wearing a form fitting Dashiki dress and red bottoms, and has a microphone in hand. )

( DING! DING! DING! )

Stephie Love: THE FOLLOWING TAG TEAM CONTEST IS SCHEDULED FOR ONE FALL AND IS TO DETERMINE THE NUMBER ONE CONTENDER TO THE EAW UNIFIED TAG TEAM CHAMPIONSHIP!

(The crowd boos as “Sound Of Silence” by Necroblasphem starts up over the arena speakers. Their jeers grow louder as the trio of Apocalypse, Donovan Cross, And Soothsayer Hamasa step out on stage. )

Stephie: Introducing first, being accompanied by Soothsayer Hamasa, at a total combined weight of 573 pounds… DONOVAN CRRROOOOSSSSSSSSS AND AAAAAAPPPPPPOOOOOCCCCCCAAAAALLLLLLYYYYYYPPPPPSSSSEEEEE!!!

Stew: Folks I’ll be honest with you right now, I shudder to think what might come if this unholy trinity were to win tonight and then go on to capture the EAW Unified Tag Team Championship! I mean that would be the key to running roughshod over all three brands, could you imagine the havoc they would cause?! All the body that would be left broken?!

Talib: There would no limit to the destruction they would rain down on EAW with! I’m telling you, these two men. Hold no regard for the well being of others, they don’t care the families of the people they put in hospitals, they have no qualms about leaving someone permanently disabled, they are the very definition of ruthless and they will show no mercy towards anybody that gets in their way!

Stew: And that goes double for tonight, Erebus Jennings and Darkane may well regret ever having crossed paths with Cross and Apocalypse by the time this match is over!

( Cross, and Apocalypse Stand in the center of the ring as Soothsayer Hamasa shares some last minute sage advice. As she finishes the opening notes of “Indestructible” by Disturbed begin to play.)

Stephie: And their opponents, Introducing first, from Parts Unknown, weighing in at 240 pounds, THE FORTHCOMING OF DARKNESS… EEEERRRRRREEEEBBBBBUUUUSSSSS JJJJJJJEEEENNNNNNIIIIIINNNNNGGGGGSSSSS!!!

( The crowd cheers wildly as Erebus steps out past the curtain.)

Stew: It was just a week ago that we got to see the heart and determination of Erebus in the main event of Dynasty! He went through a war with Apocalypse, and there are many including myself who believed that Erebus was only three seconds away from pulling off the first major upset of 2019! But as far as tonight goes the question is, after only seven days what is the physical condition of Erebus Jennings after being brutalized for most of that match including being put through a table?! And what effect will that have in this match?!

Talib: Well I’m not a doctor but there is no way he is at 100 percent tonight! And when you are in the ring with guys like Donovan Cross and Apocalypse, they won’t hesitate to exploit every weakness, every lingering injury, they will be on it like hyenas on weak prey!

( Erebus waits at the bottom of the entrance ramp. He stands unshaken as Apocalypse stares menacingly, Cross smiles Deviously, and Hamasa Dares him to enter the ring. Erebus takes off his jacket and looks ready to take them up on the offer. )

( “Wizard In Black” by Electric Wizard blasts overs the loud speakers sending the crowd into a frenzy. )

Stew: WILL YOU LISTEN TO THIS OVATION!!! JOHANNESBURG HAS COME UNGLUED HERE!

Stephie: And his Partner, from New Orleans, Louisiana, weighing in at 243 pounds… DDDDDDDAAAAAAARRRRRRKKKKKKKKKAAAAAAAAAAANNNNNNNEEEEEEEE!!!!!!

( Darkane quickly makes his way down the ramp to meet with Erebus and discuss their strategy.)

Stew: It was several weeks ago that Darkane returned to the fold by coming to the aid of Erebus Jennings, and since that moment he has drawn the ire of both Donovan Cross, and more particularly The Monster Apocalypse!

Talib: and if there is one thing that you never want to do is be on Apocalypse’s bad side! For the record Apocalypse stands nearly 7 feet tall, weighs 375 pounds, and has absolutely not a shred pity, remorse, or fear within him! He is quick as a jungle cat and just as ferocious! Darkane may be tough as nails but given enough force you can crush a nail!

Stew: It is gonna take a tremendous amount of guts and determination for both Darkane and Erebus to walk out with a win, but there are few men that I know that have quite the intestinal fortitude of Darkane and Erebus Jennings!

( Darkane and Erebus climb up to the apron, the referee places himself between both parties thus allowing Jennings and his partner to enter the ring.)

( DING DING DING! )

Stew: The referee signals for the bell as both teams are in their respective corners. It looks like Donovan Cross will start things off for his team, as will Erebus for his! Erebus wanting to lock up, but Cross playing keep away as he moves about the ring. Erebus trying to cut him off and get the collar and elbow, but Donovan slipping past him… OH A STIFF JAB LANDS FOR CROSS! Erebus shaming it off and resuming the chase, Cross still backing away, Jennings has him cornered, AND ANOTHER JAB LANDS ALLOWING CROSS TO SLIP AWAY AGAIN!

Talib: I think I see the strategy here, sending out the quicker, faster, Donovan Cross, they are gonna try and wear Erebus and Darkane our trying to chase him around the ring, then once they’re good and winded in comes Apocalypse!

Stew: Cross with that devil’s grin on his face as he makes Erebus swing and miss with the right hand! Donovan with another Jab… BUT EREBUS BLOCKS IT AND COUNTERS WITH RIGHT HOOK!!

Talib: Cross knocked right down from that one but he gets right back up! Erebus there waiting with a knife edge chop to the chest!

Crowd: WOOOOOOOO!

Stew: Erebus pressing on with those chops right to the chest, Cross’ chest starting to turn beet red! Erebus taking control of Donovan’s wrist and applies the arm wringer! Jennings keeping the pressure on that hold now as he wrenches that arm! OH! CROSS WITH A RAKE TO THE EYES!

( The referee scolds Donovan who pays no mind to the warning.)

Talib: Smart play to break out of that hold! Erebus blinded, Cross coming off the ropes… EREBUS CATCHES HIM WITH THE INVERTED ATOMIC DROP!!!

Stew: Erebus with a great counter!

Talib: More like child abuse from where I’m sitting!

Stew: Cross somehow still standing… BUT NOT FOR LONG AS EREBUS NEARLY TAKES HIS HEAD OFF WITH A WICKED DISCUS CLOTHESLINE! Donovan down on the mat-DARKNESS WRATH!! EREBUS GOING FOR THE WIN EARLY!!! BUT CROSS SQUIRMING TO THE ROPES!

Talib: Donovan remembering well what that felt like last week, he’ll be trying to avoid that one at all cost!

Stew: Cross clinging to the ropes, Erebus still hanging on to both of his feet dragging him along the bottom to his corner, Tag is made in comes Darkane!

Talib: Erebus still holding on on to Cross as Darkane takes hops up to the second turnbuckle! This is a bit uncharacteristic of him I wonder what he’s got planned here?! Darkane leaps… AND COMES CRASHING DOWN WITH A STOMP RIGHT TO THE GUT OF DONOVAN CROSS!!

Stew: Erebus back on the apron now as Darkane proceeds to repeatedly stomp the guts of Donovan Cross into mush! Cross trying to roll away, but Darkane slides after and lands one forearm blow after another to the ribs! The air getting knocked out of Donovan’s body as Darkane drags him up off the canvas! Darkane with a Waistlock, now setting up his man, He takes him up… BELLY TO BACK GUT BUSTER!! CROSS IS GONNA BE SORE FOR DAYS FROM THAT ONE! DARKANE WASTING LITTLE TIME AS HE GETS THE COVER!

Ref: OOOONNNNNEEEEE! TTTTTTTWWWWWWWOOOOO!

Talib: Cross Able to kick out! You know we talked about Darkane and Jennings’ toughness, how bout Donovan Cross here as he gets back up! Darkane ready and waiting for him… AND TAKES HIM TO THE MAT HARD WITH A TEXTBOOK T-BONE SUPLEX!!

Stew: Cross winches in Pain as Darkane put everything he had into that suplex! No cover here though as Cross is somehow able to get back to his feet quickly, But he fails to notice Darkane coming off the ropes… KITCHEN SINK! THAT RUNNING KNEE STRIKE CATCHES CROSS RIGHT IN THE STOMACH!!!

Talib: Donovan was turned inside out and went down head over feet to the mat! That knee landed with bad intentions and there might be some internal injuries for Cross!

Stew: And Donovan with holding his mid-section, a look of pain painting his face with every breath taken! Darkane off the ropes looking for it again… HEY!! THAT WITCH HAMASA!! SOOTHSAYER HAMASA PULLING DOWN THE TOP ROPE!!!

( A replay shows an angle of Darkane falling backwards over the top rope to the floor where the back of his head bounces off the very thin padding surrounding ringside!

Talib: Darkane lands hard on the arena floor, and things aren’t looking good as Apocalypse now stalking over him!

Stew : Apocalypse picking Darkane up and driving him head first into the apron! Darkane’s legs a bit wobbly, he puts up little resistance as Apocalypse rolls him back in under the bottom rope! Cross making the tag and now the monster is officially in this match! Apocalypse standing over Darkane… And now he stands ON Darkane! ALL THAT WEIGHT RIGHT ON HIS CHEST!!!!! NEARLY 400 POUNDS!!!!

Talib: The referee trying to get him off, BUT APOCALYPSE SHOVES HIM AWAY!! The official keeping his distance now, that might be what’s best for his health at the moment! And look Donovan Cross getting a kick out of this! Look as he’s getting right In the face Of Darkane! Cross up in flash and plants hard stomp right to the face of Darkane! The ref finally finding enough courage to get Cross back on the apron!

Stew: Apocalypse finally letting off of Darkane who uses the ropes to aid himself in getting to his feet! Oh and Apocalypse greeting him with an open hand chop to the chest! DARKANE ANSWERS WITH A SLAP RIGHT TO FACE!! I’M NEARLY STUNNED SPEACHLESS!

Talib: As am I, you do not want to poke the bear, and you definitely do not want to stir up the wrath of Apocalypse against you!

Stew: Apocalypse infuriated by that one, Swings with a wild right! DARKANE DUCKS IT! BIONIC ELBOW FINDS THE HEAD OF APOCALYPSE! A SECOND ELBOW LANDS! DARKANE LOOKING FOR A THIRD… APOCALYPSE BLOCKS IT AND LANDS A KNEE STRIKE RIGHT TO THE ABDOMEN!

Talib: THAT ONE SENT DARKANE BACK A FEW FEET AND DOWN TO THE MAT! Darkane back up quickly! Apocalypse charging after him… BIG BOOT! NO! DARKANE SIDE STEPS IT! THAT FOOT JUST MILLIMETERS FROM CAVING IN ALL OF DARKANE’S FACE!

Stew: Darkane from behind now, connects with a back rake! Apocalypse feeling those nails nearly tearing into his flesh as we see the red marks running down his back! Darkane sprinting behind after Apocalypse! RUNNING BULLDOG BRINGS THE BIG MAN DOWN!

Talib: BUT NOT FOR LONG AS HE IS ALREADY BACK TO A KNEE! WHAT INCREDIBLE STAMINA TO SIMPLY SHRUG GETTING PLANTED FACE FIRST INTO THE MAT LIKE THAT!

Stew: Darkane sees the monster getting back up! Darkane rebounding off the ropes.. SHINING WIZARD!! THAT ONE ECHOING THROUGHOUT THIS ENTIRE ARENA! AND APOCALYPSE RIGHT BACK UP AGAIN AFTER SHAKING OFF THAT KNEE TO THE HEAD!! DARKANE ALMOST DUMBFOUNDED!

Talib: APOCALYPSE BACK ON HIS FEET AS IF NOTHING HAPPENED!!!!!

Stew: DARKANE WITH A RIGHT HAND THAT LANDS RIGHT ON THE CHIN! IT HAS NO EFFECT HOWEVER AS APOCALYPSE REACHES OUT AND GRABS DARKANE BY THE THROAT! DARKANE STRUGGLING, TRYING TO BREAK FREE… BUT TRY AS HE MIGHT HE CAN’T! IN COMES EREBUS, AND APOCALYPSE CATCHES HIM COMING IN !! APOCALYPSE NOW WITH BOTH DARKNESS AND EREBUS BY THIER THROATS… DOUBLE ONE HANDED CHOKESLAMS! WAIT! EREBUS AND DARKANE FIGHTING BACK!!! BOTH MEN STRIKING WITH PUNCHES AND KICKS! APOCALYPSE’S GRIP LOSENS… BOTH ARE FREE FROM HIS GRASP! DARKANE AND JENNINGS NOT LETTING UP! APOCALYPSE NOW DOUBLED OVER!

Tali: WHAT ARE THESE TWO THINKING AS THEY SET UP APOCALYPSE?! BOTH OF THEM TRYING TO LIFT THE MONSTER UP… DOUBLE SUPLEX!!! IMPRESSIVE BIT OF TEAM WORK TO TAKE DOWN THE GIANT!! DARKANE QUICKLY GOONG FOR THE COVER HE MAY HAVE HIM!

Ref: OOOONNNNNEEEEE! TTTTTTTTWWWWWWWOOOOOOOO!!

Stew: WHAT POWER AS APOCALYPSE NOT ONLY KICKS OUT BUT SENDS DARKANE SORING THROUGH THE AIR! Tag made now to Erebus Jennings! Erebus on the prowl measuring Apocalypse for the the spinning forearm smash… IT CONNECTS! Apocalypse stumbling back a step but still on his feet! Erebus second forearm smash… IT LANDS FLUSH BUT APOCALYPSE STILL STANDING! Apocalypse firing back with a right hand, Erebus ducking under… AND WOW WHAT A FLOAT OVER DDT!

Stew: Apocalypse driven head first into the canvas, and for the first time in this match he’s not immediately back to his feet!

Erebus trying to pick Apocalypse up- OH FROM BEHIND DONOVAN CROSS FROM THE APRON NAILING EREBUS WITH A SHOT TO THE BACK OF THE HEAD! Erebus with a right hand for Donovan…. But Cross hopping off the apron before it’s connects! LOOK OUT APOCALYPSE IS BACK UP AND CONNECTS WITH CLOTHESLINE THAT SENDS EREBUS TO THE MAT! Apocalypse Standing over Erebus now, what’s he got planned here?! APOCALYPSE WRAPPING HIS HANDS AROUND THE THROAT OF JENNINGS AND DEADLIFTS HIM UP OFF THE CANVAS INTO A TWO HANDED CHOKE BOMB!!!

Talib: THE IMPACT FROM THAT MOVE WAS THUNDERIOUS!! and cross now all too happy to make a tag here, Apocalypse obliges! Cross coming in and lands the snap elbow drop right to the heart of Erebus Jennings! Cross looking for another… it connects! Cross with a cover!

Ref: OOOONNNNNEEEEE!

Stew: Erebus getting the shoulder up almost immediately! Cross unhappy that Jennings isn’t just laying down and dying and he begins to vent that frustration with a flurry of rights to the skull of Jennings! the referee making Cross break off of Jennings! Erebus getting back to his feet… OH CROSS NAILING HIM RIGHT IN THE CHOPS WITH A THRUST KICK THAT ECHOS THROUGH THE ARENA!!! Erebus down on the mat, Cross coming off the ropes looking for the running senton… IT LANDS!! Donovan not done yet as he is back up and dropping the knee right to the skull! A second… third… fourth… Cross hopping up onto the middle turnbuckle… AND A FIFTH KNEE DROP COMES DOWN CRUSHING THE SKULL OF EREBUS JENNINGS!!!

Talib: Cross not bothering with a cover, that’s a mistake in my book, instead he picks up Jennings by the head and sends him face first into the turnbuckle! Cross with a stiff kick to the ribs! Followed quickly with a back elbow strike to the temple! NOW DONOVAN WITH A BLATANT CHOKE!!!

Ref: 1! 2! 3! 4!

Talib: Donovan releases the choke, the referee scolding Cross warning him to keep it clean!

Stew: BUT AS HE DOES SO APOCALYPSE BEGINS CHOKING EREBUS OUT WITH THE TAG ROPE!! DARKANE TRYING TO GET IN THE RING BUT THE REFEREE ARGUES WITH HIM TO GET BACK ON THE APRON!! CROSS AND APOCALYPSE TAKING ADVANTAGE OF THE DISTRACTION WITH CROSS TAKING SEVERAL CHEEP SHOTS TO THE RIBS WHILE APOCALYPSE ATTEMPTS TO STRANGLE THE LIFE OUT OF EREBUS!!!

Talib: The referee finally turning his attention back to the match, Apocalypse letting go of that rope allowing Jennings a chance to catch his breath! Cross directing traffic now as he tags in Apocalypse

Donovan Cross ( no mic ): Turn his ribs into dust!

Talib: Nobody here will ever accuse Donovan of not being vindictive as they come! Apocalypse comes in AND LANDS WITH A BARRAGE OF BALLISTIC SHOULDER THRUSTS RIGHT TO THE MID-SECTION OF EREBUS!! EREBUS MAY HAVE HAD THE WIND KNOCKED OUT OF HIM!!

Stew: Apocalypse now taking a few steps back, what’s he thinking now?! Apocalypse charging at Jennings… SPRINTING HIGH KNEE!! MISSING!!! EREBUS ABLE TO MOVE OUT OF THE WAY AND APOCALYPSE’S KNEE HITTING WITH ALL HIS MIGHT INTO THAT TURNBUCKLE!!!

Talib: Apocalypse obviously in a lot of pain as he goes down to a knee! EREBUS HOPS UP ON HIS BACK AND APPLIES A SLEEPER HOLD!!! SHADES OF LAST WEEK HERE AS EREBUS TRIES TO PUT THE MONSTER DOWN WITH THIS HOLD!! APOCALYPSE SOMEHOW RISING TO HIS FEET WITH EREBUS ON HIS BACK!! THIS MIGHT WORK AGAINST HIM THOUGH BECAUSE THE MORE YOU TRY TO FIGHT OUT OF A SLEEPER THE QUICKER YOU SUCCUMB TO IT!!

Stew: APOCALYPSE LIKE A RAGING BULL WITH EREBUS HANGING ON FOR DEAR LIFE!! APOCALYPSE LOOKS LOKE HE’S STARTING TO FADE… OH! APOCALYPSE LEAPING BACKWARDS AND CRUSHING EREBUS AGAINST THE MAT!! NEARLY 400 POUNDS CAME DOWN ON TOP OF EREBUS!

Talib: Darkane reaches out as far as he can, Erebus stirring, trying to crawl towards his corner! Erebus reaching out but just a hair short… OH APOCALYPSE WITH A STOMP TO THE BACK!! Apocalypse looking like something out of a monster movie as he drags Erebus back to his corner by the leg! Erebus trying to claw his way back, but it’s no use Apocalypse tagging out here, Cross the legal man climbing up the turnbuckles as Apocalypse holds Jennings down, Cross measuring… DIVING SENTON!!! DONOVAN CROSS COMING OFF THE TOP ROPE AND JENNINGS WOULD BE LUCKY IF HIS RIBS WERE JUST BRUISED FROM ALL THIS PUNISHMENT! CROSS WITH THE COVER, HOOKS THE LEG, THIS HAS GOT TO BE OVER!!

Ref: OOOONNNNNEEEEE! TTTTTTTWWWWWWOOOOOOO!!

Stew: EREBUS SOMEHOW GETTING THE SHOULDER UP BEFORE THE THREE COUNT!! And Soothsayer Hamasa voicing her complaints about that count loudly! She says that should have been three but I personally thought it was a fair count!

Talib: THAT REF SHOULD HAVE CALLED FOR THE BELL! ITS A NO CALL HERE AT KING OF ELITE AND THATS WHY NOBODY CARES WHAT YOU THINK STEW!

Stew: 🙁

Talib: BACK TO THE ACTION! Cross picking up Jennings by the head, he sets him up and lifts him to a powerbomb position… GRAVE CONSEQUENCES!!! CROSS DROPPING EREBUS BACK FIRST ACROSS HIS KNEES!! CROSS WITH THE COVER!!

Ref: OOOONNNNNEEEEE! TTTTTWWWWWWOOOOOOO!!!

Stew: EREBUS GETTING THE SHOULDER UP AT 2 & 7/8THS!!! DONOVAN CROSS BANGING ON THE MAT IN FRUSTRATION AS EREBUS REFUSES TO GO DOWN WHILE THERE IS A BREATH IN HIS BODY!!! Cross trying to think up his next mo-uh oh! Cross is smiling and when he smiles bad things happen to his opponents!

( Cross rises up with his hands in a crucifix position. )

Talib: You can see Cross calling for it here as he lays in wait for Jennings who is slow to get to his feet! Erebus needing to use the ropes to pick himself up, Donovan meeting him with a kick to the gut! AND HERE WE GO DONOVAN HAS HIM SET UP FOR DIE ON THE CROSS!! CROSS LIFTING HIM UP… BUT EREBUS ABLE TO SHIFT HIS WEIGHT TO BLOCK IT!! Donovan with a club to the back, BUT EREBUS WITH A DOUBLE LEG TAKEDOWN!!

Stew: DARKNESS’ WRATH!! NO! CROSS USING HIS LEGS TO SHOVE EREBUS BACK DOWN TO THE CANVAS!!! Both men getting back to their feet, Cross a step ahead shoots himself off the ropes! SIT OUT SPINE BUSTER!!! EREBUS WITH THAT HUGE MOVE THAT ABSOLUTELY PLANTED DONOVAN CROSS!!!

Talib: And Darkane now beating on the turnbuckle trying to get Jennings over to the corner! Erebus May have used the last bit of energy he had on that spine buster! Cross starting to stir and he wisely starts heading towards Apocalypse! Both men crawling!

Stew: TAG TO APOCALYPSE! Apocalypse Charges at Erebus and Leaps with a huge elbow drop! BUT EREBUS ROLLS OUT OF THE WAY!!! EREBUS LEAPS… AND THE TAG IS MADE!! DARKANE WITH A FIRE LIT UNDER HIM AS HE SPOTS APOCALYPSE GETTING BACK UP TO HIS KNEES AND ASSULTS THE MONSTER WITH LEFTS AND RIGHTS FASTER THAN A FREAKING MACHINE GUN!! APOCALYPSE COVERING UP TO DEFEND HIMSELF, DARKANE PLANTS A HARD KICK TO THE ABDOMEN! DARKANE WITH THE FRONT FACE LOCK ON THE MONSTER AND WE KNOW WHATS NEXT… OH DONOVAN CROSS FROM BEHIND SAVING APOCALYPSE FROM ENTER THE GRAVE!!

Talib: Cross has Darkane up against the ropes! Cross with kick aimed to the head… BUT DARKANE COUNTERS WITH AN EXPLODER SUPLEX THAT SENDS DONOVAN DOWN TO THE FLOOR!!! Apocalypse back up and he rushes at Darkane with a clothesline! Darkane Ducks underneath… AND LANDS A CACTUS CLOTHESLINE THAT SENDS BOTH HIM AND APOCALYPSE OVER THE TOP ROPE!!!

Ref: 1!

Stew: Darkane the first man back to his feet, Cross not too far behind… DONOVAN EATS A HARD RIGHT HAND! But look out Apocalypse back up and lands a club to the back that takes Darkane down!

Ref: 2!

Stew: Cross and Apocalypse stomping away at Darkane here but look out…

Ref: 3!

Talib: DIVING CLOTHESLINE!!! EREBUS JENNINGS THROWING CAUTION TO THE WIND AS HE COMES OFF THE TOP ROPE AND DOWN ON BOTH DONOVAN CROSS AND APOCALYPSE HERE ON THE ARENA FLOOR!!!!

( A replay of Erebus’ incredible dive airs side by side with the live action footage. )

Stew: ALL FOUR MEN ARE DOWN HERE AT RINGSIDE!! WHAT A TOLL IT HAS TAKEN ON ALL OF THESE MEN! Darkane up first, he goes over and helps up his tag partner and together the two of them proceed to roll Apocalypse into the ring under the bottom rope!

Talib: Both men following closely behind, Apocalypse trying to get back to his vertical base but both Darkane and Erebus lay into him with hard strikes! Erebus and Darkane now with the double Irish Whip… and it sends apocalypse into the corner! Darkane directing traffic here now as Erebus whips him into the corner… WHIP ASSISTED STINGER SPLASH FROM DARKANE!!! THAT ONE CRASHING HARD INTO THE MONSTER APOCALYPSE!! Darkane now returning the favor… STINGER SPLASH FROM EREBUS JENNINGS!!!

Stew: APOCALYPSE STUMBLING OUT OF THE CORNER, DARKANE WITH A BOOT TO THE MID- SECTION… ENTER THE GRAVE!!! THE EVENFLOW DDT DRIVES APOCALYPSE FACE FIRST INTO THE MAT!!! DARKANE WITH THE COVER!!

Ref: OOOONNNNNEEEEE! TTTWWWWOOOO!!! TTTTTTTHHHHHRRRRRREEEEEE-

Talib: AND DONOVAN CROSS WITH THE SAVE!!!

Stew: CROSS SETTING DARKANE UP! HE’S LOOKING FOR DIE ON THE CROSS… PPPPPPIIIIIITTTTTCCCCCCHHHH BBBBBBLLLLLLAAAAACCCCCCCKKKKKKKKKKKK!!!!!! EREBUS WITH THE SAVE PLANTING THE BACK OF CROSS’ SKULL INTO THE CANVAS!!! Cross rolling out of the ring under the bottom rope, Apocalypse rising to his feet, DARKANE OFF THE ROPES… DDDDDDDEEEEEEEVVVVVVIIIIILLLLLLL MMMMMAAAAAYYYYY CCCCCCRRRRRYYYYY!!!! SPEAR RIGHT TO THE SPINE OF APOCALYPSE!!! DARKANE ON TOP FOR THE COVER!!! EREBUS STACKS ON TOP OF HIM FOR GOOD MEASURE!!!

Ref: OOOONNNNNEEEEE! TTTTTTTWWWWWWOOOOOO!! TTTTTTHHHHHHHHRRRRRRREEEEEEEEEE!!!

( DING! DING! DING! )

( “Wizard In Black” hits over the arena speakers as the crowd cheers wildly. )

Stephie Love: Ladies and Gentlemen here are your winners… DARKANE AND EREBUS JENNINGS!!!!

Stew: WORDS CANNOT DESCRIBE THE HEART, THE RESILIENCY, AND THE UNWAVERING DETERMINATION THAT BOTH THESE MEN PUT ON DISPLAY HERE TONIGHT!!

Talib: WELL YOU COULD SAY THIS WAS A MATCH WERE BAD MEETS EVIL, AND THERE WERE SEVERAL TIMES I NOT JUST THOUGHT BUT KNEW FOR SURE THAT CROSS AND APOCALYPSE HAD THIS MATCH IN THE BAG! BUT LOW AND BEHOLD, LET NO MAN EVER QUESTION THE TOUGHNESS AND THE TALENT OF EITHER OF THESE TWO MEN AGAIN!

( Apocalypse rolls out of the ring under the bottom rope where Soothsayer Hamasa leads both him and Donovan Cross up the ramp. Meanwhile in the ring Erebus and Darkane stand in the center of the ring shaking hands.)

Stew: A job well done by both of these men, my hat is off to them-WHAT THE HELL?!?

( An individual dressed in all black tactical gear, wearing a diamond studded mask with occult imagery painted all over it enters the ring with a chair. )

Talib: WHO THE HELL IS THAT?!

( The individual stranger first smashes the chair over the head of Erebus before doing the same to Darkane. )

Stew: IF I HAD TO PREDICT, I’D SAY IT’S ANOTHER ONE OF OUR CHAIRMAN’S HIRED GOONS THATS FOR DAMN SURE!! THIS MASKED MAN VICIOUSLY BLASTING EREBUS AND DARKANE WITH THAT CHAIR WHILE THEY ARE DOWN ON THE MAT!

( The masked man kicks Erebus out of the ring under the bottom rope.)

Stew: DARKANE TRYING TO GET BACK UP, HE’S BEEN BUSTED OPEN BUT HE IS STILL FIGHT BY GOD… OH! ANOTHER CHAIR SHOT RIGHT TO THE SKULL!! DARKANE OUT FLAT ON THE MAT!!!!!

Talib: That masked assailant tossing away that chair and daring Darkane to get back up! Darkane slowly dragging himself up to his feet with the aid of the ropes, he on wobbly legs as he turns to face the masked man….. WAIT A SECOND!!!! SPEAR!!!!!!!!!

( The Masked Man stands over Darkane and peels off his masks to reveal… MR. DEDEDE. )

Stew: ITS DEDEDE!! OUR CHAIRMAN HAS JUST ASSAULTED DARKANE AND LEFT HIM LAYING!!!

Mr. DEDEDE (no mic): YOU STILL WANT A PIECE OF ME NOW YOU SON OF A BITCH?! I’M RIGHT HERE!!!

Stew: DARKANE OUT LIKE A LIGHT- AND WHAT IS DEDEDE UP TO?! HE’S OUT HERE RIGHT IN FRONT OF US AND… HE’S GRABBING ANOTHER CHAIR!!

Talib: STEW I DID NOT LIKE THE LOOK IN HIS EYES AS HE PICKED UP THAT CHAIR!!

Stew: DEDEDE SLIDING BACK INTO THE RING WITH THAT CHAIR IN HAND! OH AND LOOK AT HIM AS HE KICKS DARKANE WHILE HE’S DOWN!! DEDEDE HAS DARKANE LAID OUT ON THAT CHAIR FROM EARLIER! C’MON DON’T DO THIS! DEDEDE WINDING UP! DARKANE MOTIONLESS………….. CONCHAIRTO!!!!!

( Blood begins pouring from Darkane’s head and flows across the canvas like a river. )

Talib: MY GOD DEDEDE THAT HEARTLESS BASTARD JUST SANDWICHED DARKANE’S HEAD BETWEEN TWO CHAIRS!!! OH MY GOD!! GAWDZILLA IS BACK!!!

( DEDEDE struts around the ring playing guitar for the chair, showing off for the booing audience before stepping through the ropes and chair-guitarring up the ramp. )

Talib: THAT… THAT WAS TOO FAR! DARKANE MUST BE CONCUSSED!!

Stew: A SADISTIC AND SATISFIED SMILE PLASTERED ALL OVER OUR CHAIRMAN’S FACE! IT’S AS THOUGH NOTHING’S CHANGED ABOUT HIM AT ALL, IF ANYTHING THAT LOOK IN HIS EYES MAY VERY WELL INDICATE THAT HE’S ONLY GOTTEN WORSE.

( The final shot shows Darkane and Erebus writhing in pain, being tended to by several officials who are throwing up the “X” and calling for medical help. )

(Brief intermission as the officials remove Darkane and Erebus from the ring.)

Gina Romano: The following contest is a SINGLES MATCH scheduled for…

Crowd: ONE FALL!

Gina Romano: And it is for the E-A-W- Openweight Championship!

(“Blackout” by Company Flow picks up throughout the arena as Lethal Consequences arrives on stage, embracing the mixed, but mostly negative crowd reaction.)

Gina Romano: Introducing first, the challenger, weighing in at two-hundred and thirty pounds, from Oakland, California….LLLLLLLEEEEEEETHAAAAAAAAAALLL CONNNNNSEQUENNNNNCCCCESSSSSS!

(Lethal Consequences enters the ring and poses for the booing arena. He waves his hands away and shakes his head as he reports to his corner of the ring.)

(“Ambitionz as a Ridah” by Tupac begins to blare throughout the arena speakers as the crowd goes wild in anticipation for the arrival of their Openweight Champion. Eventually, TLA comes out in a bright blue lowrider, representative of the Showdown brand. As he drives onto the stage, the car is surrounded by several bitches hailing from the Poon Palace in Johannesburg, also all wearing blue, and cheering for TLA.)

Gina Romano: AND HIS OPPONENT! Weighing in at two-hundred and ten pounds, from Tlaxcla, Mexico….he is the E-A-W- Openweight Champion, TEEEEEEEEEEE! ELLLLLLLLLLL! AAAAAAAAAAAAYYYYYYYEEEEE!

(TLA hops out of the lowrider with the Openweight title around his waist. He slaps the face of the belt a few times before telling the Poon Palace bitches to “véte de aquí” and he makes his way down the ramp alone. He enters the ring and hands his title off to the official as the music dies down, not taking his eyes off of Lethal Consequences who stands comfortably in a corner. The referee holds the championship in the air before ringing the bell.)

(Ding! Ding! Ding!)

Eve: Here we go, y’all! For Showdown! TLA has had enough of the taunts! TLA goes straight after Lethal Consequences with a huge clothesline — LC ducks it! He ducks right under the arm and slips behind TLA — TLA doesn’t know what hit him, the brief moment of confusion on the face of TLA as LC lands a textbook German suplex to TLA! LC gathers himself up, TLA just about to pull himself up, but LC with a hard stomp to the skull! He goes for another — but TLA catches the boot—he pushes LC off of him, who stumbles into the turnbuckle corner! TLA gathers himself, scurries up off the floor, and charges straight after LC — who reverses the running attack by TLA once again! The Openweight Champion was smashed right into turnbuckle cover, and now finds himself with his back turned to Lethal Consequences who flips him right around! LC now with — PHEW! A HARD CHOP TO TLA’S CHEST, WHICH IS NOW A BRIGHT SHADE OF RED! That chop was heard throughout the entire arena! Now LC hops onto the middle rope of the turnbuckle, grabbing TLA by the back of the neck — punch after punch directly to the skull of TLA!

Deadprez: Now, here goes Lethal Consequences, taunting the crowd as they boo him! Look at him! He loves it! Watch LC as he basks in the negative reaction from the EAW Universe! Absolutely zero regard for their beloved Champion — THE CHAMPION WHO SEES HIS OPPORTUNITY TO REGAIN CONTROL OF THIS MATCHUP! A PUNCH TO THE MIDSECTION OF LC! ANOTHER! But LC sees the predicament here! He hops up to the top rope now, up from the middle! Looking for a hurricanrana — but TLA with another punch to LC’s gut! LC FALLS BACKWARDS! BUT HIS LEGS — HIS LEGS ARE CAUGHT ON THE ROPES! LC finds himself stuck in a tree of woe at the mercy of TLA! LC tries to set himself free — he hoists himself up, trying to grab a hold of his legs and free himself — OOOH! TLA WITH A DOUBLE FOOT STOMP FROM THE TOP ROPE TO THE CHEST OF LC! AND THAT PLANTS LC RIGHT ONTO THE MAT, FREE FROM THE TURNBUCKLE! TLA grabs LC by the arms — drags him to the center of the ring, for the cover!

Referee: OOOOOOONE! TWWWWOOOOO —

Eve: Kickout by Lethal Consequences! He gets the shoulder up, but TLA is still in control of this one — he gets up, but not before landing a few punches to the head of LC — what’s this now — STANDING MOONSAULT ONTO LETHAL CONSEQUENCES FROM THE OPENWEIGHT CHAMPION! Beautifully executed move by TLA who now pulls LC up by what little hair he has left! TLA goes for an irish whip to ropes — TLA bouncing off the ropes on his side as he meets LC with — FLYING CROSSBODY CONNECTS! LC flops like a fish on the mat from the impact of that crossbody from TLA! And TLA sees another opportunity here! The crowd goes nuts as he looks towards the top turnbuckle! TLA gets up top — but LC rolls underneath the bottom rope!

Deadprez: And the crowd can’t stand it! They’re booing the HELL out of Lethal Consequences! TLA hops down from the top turnbuckle as LC tries to gather himself against the barricade here at ringside. But that won’t stop the luchador from going for another high risk move — LC doesn’t see him, but TLA’s got his sights set — SUICIDE DIVE! SUICIDE DIVE TO THE OUTSIDE OF THE RING STRAIGHT INTO LETHAL CONSEQUENCES! AND THE IMPACT BREAKS THE BARRICADE! THE CROWD CAN’T BELIEVE IT!

Crowd: HOLY SHIT! HOLY SHIT! HOLY SHIT!

Eve: MY GOD! NEITHER MAN IS MOVING! THEY MIGHT BE DEAD! The referee has no choice but to start the count — but remember, folks, if either man gets counted out, TLA will retain! And that is the last thing LC needs in this one, to miss another important opportunity to bring his career to new heights! And speaking of which, LC is getting up! The man can barely stand on his own two feet! LC on spaghetti legs here as the referee begins the count!

1…..!

2…..!

Deadprez: LC reaches the apron —

3…..!

Eve: TLA starting to remember where he’s at! He’s pushing that broken barricade out of his way and is looking for LC — even if a countout would work in his favor here, TLA wants to make sure LC gets what’s coming to him!

4…..!

Deadprez: LC slides underneath the bottom rope —

5…..!

6…..!

Deadprez: And LC slips right back out of the ring! Just to break the ref’s count! The referee forced to start over!

Referee: C’mon! I need you both in the ring! Let’s go!

Eve: But LC is met by TLA who has found his footing — TLA with a European — excuse me, *Very* Mexican Uppercut! LC stumbles backwards, and onto the apron — TLA now with some swift punches to the skull of Lethal Consequences — and LC begins to fight back! LC with a European uppercut of his own! More strikes from both sides! LC with a hard forearm to TLA, who now looks dazed! LC grabs him by the arm — AND DRIVES HIM SHOULDER FIRST, STRAIGHT INTO THE STEEL RINGPOST! This doesn’t look good for the Openweight Champion — LC now in total control of this one — again, sliding in and out of the ring to make sure the referee doesn’t get the chance to count all the way to ten!

Deadprez: LC again soaking the reaction in from the crowd — they boo as he spits on TLA who’s now lying on the ground, absolutely defenseless as LC jumps onto the apron for a brief moment — what’s he doing here — A LEG DROP TO TLA ON THE OUTSIDE OF THE RING! RIGHT ON THE NECK OF THE OPENWEIGHT CHAMPION! LC might be looking for the finish here — he grabs TLA, pulls him up, and drags him to apron, ready to throw him into the ring. Hold on! Wait a minute — who’s that on her way to the ring?

Eve: I haven’t the slightest idea — from here, it sort of looks like — some really old lady! Is that Amber Keys?

Deadprez: What?! No! That’s not Amber Keys — that’s TLA’s abuela! TLA’s supposed grandmother — Abuela Pantera — she’s here in Johannesburg! But what in the world is she doing here? And what is that she has in her hand?!

Eve: This is unbelievable. LC looks just as stunned as the rest of the FNB stadium tonight! She’s made it to ringside — LC almost looks like he wants to shoo her away, but something tells me he doesn’t want to cross that woman at all! The look in her eyes says it all! LC slides back into the ring, and out of harm’s way, leaving TLA on the outside of the ring, completely unaware of his whereabouts!

Abuela Pantera: ¡HIJO! ¡Levanta tu trasero!

Deadprez: TLA is stirring now — Abuela Pantera reaches him on the outside of the ring — AND THE PANIC SETS IN! TLA SCRAMBLES UP OFF THE FLOOR! WHATEVER SHE HAS IN HER HANDS, TLA WANTS NOTHING TO DO WITH IT! And now he’s pleading with his Abuela as she chases him around the ring!

Abuela Pantera: ¿Oh? Ahora quieres moverte? ¡Entra en ese anillo y lucha!

Deadprez: I KNOW WHAT THAT IS! SHE HAS THE CHANCLA! Abuela Pantera is threatening TLA with that chancla — the slipper! She has a slipper in her hand and — I’m sorry, I just don’t understand how this instills so much fear into the Openweight Champion with nothing but a slipper!

Eve: It wasn’t meant for you to understand, Deadprez! Just know that you can’t cross an abuela, I speak from experience — especially one with as much street cred as the Abuela Pantera!

Deadprez: :dahell:

Abuela Pantera: ¡No seas una perra! A menos que quieras Perro Esteroide para follarte!

TLA: ¡Abuela, lo siento! Por favor!

Abuela Pantera: ¡No te disculpes conmigo! Será tu culpa si pierdes!

TLA: :damn:

Deadprez: Whatever it is about that chancla — it worked! Abuela Pantera has successfully motivated TLA to get his ass up and get back in this matchup! TLA has slid back into the ring, where Lethal Consequences is ready and waiting — LC hardly lets TLA back into the ring before he uses those ropes to leverage himself while he begins another stomp attack to TLA’s back! The damage has been done, LC certainly played it smart when wearing down the Champion before Abuela came through — but TLA is standing up, the strikes from LC’s boots aren’t phasing him! TLA with a right hand — LC with a right hand of his own — AND A DROPKICK BY TLA ONTO LC! LC FALLS ON HIS BACK — TLA WITH A KICK TO THE MIDSECTION — OH MY, HE GRABS LC BY THE LEGS! HE LOCKS THEM IN, FLIPS LC OVER ON HIS STOMACH! YES! THERE IT IS! HE’S GOING FOR IT! THE AR15! LC IS GOING TO TAP OUT! TLA HAS GOT THE HOLD LOCKED IN! LC SCREAMING AND WRITHING IN PAIN! THE CROWD IS GOING CRAZY! LC WITH NOWHERE TO GO! CAN THIS BE IT?! WILL TLA RETAIN?!

Eve: NO! NO! LETHAL CONSEQUENCES BREAKS OUT OF IT! BY SOME GREAT FORCE OF NATURE, LC HAS POWERED OUT OF THE AR15! TLA CAN HARDLY BELIEVE IT HIMSELF! HE JUMPS TO HIS FEET — TLA SCURRIES UP OFF THE GROUND — HE CHARGES AFTER LC, BUT LC DODGES A RUNNING FOREARM ATTEMPT — OH GOD, I SEE IT COMING — YES! ACID REIGN! ACID REIGN FROM LETHAL CONSEQUENCES ONTO TLA! TLA IS DONE! ABSOLUTELY FINISHED! I DON’T THINK HE CAN TAKE ANYMORE! LC GOES FOR THE COVER —

Referee: OOOOOOOONE! TWWWWOOO! THREEEEEEEEEEEE

Deadprez: WHAT THE HELL! WHAT THE HELL! WHAT IN GOD’S NAME!

Eve: PRINCE OF PHENOMENAL — POP IS HERE! POP IS RUNNING DOWN THE RAMP! WHAT THE HELL IS GOING ON HERE?!

Deadprez: LETHAL CONSEQUENCES SEES HIM — HE TURNS HIS BACK TO TLA! POP JUMPS ONTO THE APRON! THE REFEREE IS TRYING TO GET HIM OUT OF HERE! BUT LETHAL CONSEQUENCES IS TRYING TO PUSH PAST THE REF! HE WANTS HIS HANDS ON PRINCE OF PHENOMENAL! POP is simply laughing as LC is damn near about to start foaming at the mouth, in complete disbelief that POP is out here trying to distract him at a moment like this!

Eve: And what is this? POP just — he hops down from the apron. Huh. How anticlimactic. POP looks like — What?! He’s leaving! He glares at LC as LC leans over the ropes, talking more trash to POP as the referee tries to get him under control. Prince of Phenomenal begins walking back up the ramp, shaking his head! I don’t understand! All this commotion for nothing? Is this all just a game to POP? Why come out here if he had no intentions of —

Deadprez: THE MEXICAN DESTROYER! MEXICAN DESTROYER! TLA CAUGHT LC OFF GUARD! GODDAMMIT! GODDAMMIT! LC WAS ROBBED! TLA WAS DOWN AND OUT BEFORE POP CAME OUT HERE, AND GAVE TLA JUST ENOUGH TIME TO RECOVER! I DON’T EVEN KNOW HOW HE DID IT! TLA HAD NOTHING LEFT IN HIM AFTER THE ACID REIGN! THIS IS DESPERATION FROM THE OPENWEIGHT CHAMPION IF I’VE EVER SEEN IT BEFORE! TLA CRAWLS OVER LC, HE BARELY GETS AN ARM OVER HIM — ABUELA IS SCREAMING! THE CROWD HAS LOST THEIR MINDS! THE REFEREE GOES FOR THE COUNT —

Referee: OOOOOOOOOOONE! TWWWWWWWWWWWOOOOO! THHHHHHRRRRRRRREEEEEEEEEEEE!

(Ding! Ding! Ding!)

(“Ambitionz as a Ridah” begins to play throughout the arena as TLA lays flat on his back with a smile forming across his face. The crowd roars as TLA is handed his Openweight Championship. He lets the title drape across his stomach before wrapping his arms around the belt.)

Gina Romano: Here is your winner, and SSSSSSSSTIIIIIIILLLLL THE E-A-W OPENWEIGHT CHAMPION….TEEEEEEEEEEEE! ELLLLLLLLLLLLLL! AAAAAAAAAAAYYYYYYYYYYYEEEEEEE!

Eve: Well, it took a slipper and a Prince to get it done, but TLA has successfully retained his Openweight Championship here tonight, despite the great effort by Lethal Consequences! Sounds like a fairytale ending to me! :troll:

Deadprez: This is no Cinderella story, Eve! At least not for LC! After everything Lethal Consequences has had to put up with since his return to EAW, this has got to hurt the most! Prince of Phenomenal has cost LC a monumental opportunity here tonight, as he was only moments away from regaining some championship gold.

Eve: Don’t count him out just yet, ‘Prez. Lethal Consequences is a man who’s been written off many times just to pick back up and come back in full force, time and time again!

Deadprez: Very true, Eve. I’d hate to see what he does next to try and restablish himself next. And after what POP just cost him? Whew. But thankfully for us, that’s now Voltage’s problem to deal with! :umad:

Eve: :umad:

(TLA, now standing, grips his championship in one hand, and holds the ropes open for his Abuela Pantera so that she may enter the ring. The crowd begins an enthusiastic “abuela” chant as TLA hugs his grandmother in the center of the ring. The final shot is of Lethal Consequences fuming with rage as he stomps up the ramp, presumably looking for the man who cost him his shot at a championship.)

Bella Braxton: The following match is for the Unified Tag Team Championships!!

James Peters: This is it! The winners of the Grand Prix tournament, Kassidy Heart and Sienna Jade are getting their chance, Rich. The former Empire Tag Team Champions stepping up to challenge MarrKade.

Rich Russillio: And what a challenge that is going to be. MarrKade have been through battles in the EAW, not to say that the Hearts haven’t, but they’re the tag team champions for a reason – James.

( ‘True Love’ is the first theme song to play, and immediately the Johannesburg crowd gives a mixed reaction to the two gold-clad individuals that emerged onto the stage. Both in a literal and figurative sense. Kassidy Heart and Sienna Jade walked out onto the stage, wearing matching gold attire – but also both wearing their respective championships around their waists, and holding the Tag Team of the Year awards in their hands. Sienna is especially shining bright tonight having disposed of Madison Kaline and Astraea Jordan earlier in the evening.)

Bella Braxton: Introducing first, the winners of the 2018 Grand Prix … the Empire VIXEN’S CHAMPION … and the Empire UNIFIED WOMEN’S WORLD CHAMPION .. They are the 2018 Tag Team of the Year … Kassidy Heart and Sienna Jade … THE JADED HEARTS!!

Rich Russillio: Look at these two, James. Did you hear all of those accolades mentioned?! Tag team of the year, Grand Prix winners, Vixen’s and Women’s World Champions. Could they really pull off the win tonight and add Unified Tag Team Champions to their resume?

James Peters: Of course! They are REVOLT! Royalty!!! Not to mention they held the Empire Tag Team Championships as well, Rich. They’re very decorated, and driven to break barriers and become the Tag Team champions. It’s going to be a tough road for them, but they have a chance.

(Sienna and Kassidy take their time entering the ring, making sure to show off their championships and trophies before taking a moment to stop for photo op in the center of the ring, hoisting their titles and trophies together.)

(‘Glory’ by the Score (the band, not the stable) overpowers the romantic ballad that the Hearts use, and immediately the tandem of Charlie Marr and Daryl Kinkade make their way onto the stage. Daryl proudly wearing his championship around his waist , while Charlie holds his by the strap – letting the other end drag along the steel ramp.)

Bella Braxton: And their opponents – they are the EAW UNIFIED TAG TEAM CHAMPIONS …. Charlie Marr and Daryl Kinkade … MARRKADE!!

(Daryl takes a second to play to the crowd, but not Charlie. He doesn’t play those games. He’s stopped in front of the ring, never taking his eyes off of Kassidy and Sienna.)

James Peters: Look at the intensity behind Charlie’s eyes. He’s focused on destroying these two ‘bimbos’. He didn’t quite say that, but that is a very toned down version of what he’s said. He has a mean streak in him, and if given the chance I’m sure he would love to do some damage to them.

Rich Russillio: You’re absolutely right. It’s hard to find someone who matches his intensity level. That has been a driving force in the reign of MarrKade, and I can tell you for sure that he has no intention of easing off of the pedal tonight. Neither does Daryl. These guys are former co-National Elite champions, don’t forget that. They know what they’re doing in the ring.

(Charlie and Daryl finally enter the ring, handing the Tag Team Championships to the referee, who raises them high in the air. The prize that’s on the line tonight. Kassidy and Sienna have already given their titles and trophies to ringside crew, and now have their eyes on the tag titles being showcased right now.)

(Ding! Ding! Ding!)

Rich Russillio: Kassidy starting this one, allowing Sienna to stand on the outside. She had a grueling match for the Women’s World Championship earlier and you have to ask yourself whether or not she’s okay to compete in this match. Charlie Marr has a smile on his face, knowing that one of the Hearts is weak. And he elects Daryl to start off against Kassidy.

James Peters: Daryl climbs into the ring and begins to circle one way, while Kassidy goes the other. Two of the top teams in the EAW squaring off for the titles, and the fans in Johannesburg are electric for this showdown. Kassidy passing by Charlie now, making sure to keep an eye on him as he fakes out a reach to grab her.

Rich Russillio: Daryl spotted that momentary glance away and rushes in, hitting Kassidy with a blindside elbow. Kassidy moves against the ropes, only to come back with an elbow of her own – and the two now trade shots. Forearm by Daryl, forearm by Kassidy. Elbow to the chin from Daryl, another forearm shiver from Kassidy that pushes Daryl back a few steps. Roundhouse kick from Daryl.. NO! Kassidy dodged, avoiding the kick that would have taken her head off. Daryl’s own momentum spins him around … GERMAN SUPLEX!

James Peters: What timing from Kassidy! In the split second that Daryl was in that spin after missing the roundhouse kick, Kassidy grabbed him and executed a perfect snap German suplex. Daryl hit the mat on his neck, but rolls up to a knee and is just staring up at Kassidy, who eggs him on by motioning with her hand to ‘come on’.

Rich Russillio: Exploding to his feet, Daryl charges to Kassidy – quickly hitting her with a flurry of strikes that she absorbs. Kicks, palm strikes, capped off with a discus elbow that leaves her rocking. Daryl turns, sprints to the ropes and comes back with a huge running European Uppercut! Kassidy stumbles into the ropes and Daryl follows her in … Kassidy strikes back with a thrusting side kick that doubles Daryl over! She turns to, and jumps up onto the middle rope – springboarding.. HURRICANRANA!!

James Peters: Unique way to get out of the ropes and turn momentum to her favor again. Daryl is whipped down to the mat and he’s rolled toward his corner. TAG. Charlie Marr reaches over and tags himself in. Kassidy just returning to her feet with only enough time to look up.. CLOTHESLINE by Charlie! Kassidy is hit hard with that stiff clothesline, and Charlie’s not done. He rushes into the Jaded Heart corner and blasts Sienna in the face, knocking her off of the apron.

Rich Russillio: Charlie’s grabbed Kassidy by the hair, pulling her up to her feet only to toss her through the ropes and onto the floor with her partner. Now he’s turned to Daryl and is shouting at him.

James Peters: Daryl’s nodded his head at Charlie and pushes himself up to his feet, where he charges… SUICIDE DIVE THROUGH THE ROPES, TAKING OUT BOTH KASSIDY AND SIENNA!

Rich Russillio: Daryl’s up to his feet and he meets with Charlie who’s exited the ring. Both of them grab each of the Hearts, lifting them up. The Hearts fight back, though! Striking Daryl and Charlie to free themselves of the grip of the champions. Sienna with a well-placed front kick to Charlie’s kneecap, sending him down to one knee, and she turns to help Kassidy with Daryl.

James Peters: Sienna and Kassidy grabbing each of Daryl’s arms – whipping him shoulder first into the steel turnbuckle. Daryl’s slumped down, holding his shoulder in pain.. AND KASSIDY GRABS HIS HEAD, SLAMMING IT INTO THE POST! OVER, AND OVER AGAIN!

Rich Russillio: Daryl is out cold, it looks like. The referee up to a five count and both Kassidy and Sienna have turned to the legal Charlie Marr and roll him into the ring. He’s still favoring that knee some, James.

James Peters: Kassidy’s returned to the ring, stopping the referee’s count completely, and tags in Sienna. The Jaded Hearts have their eyes on Charlie. Approaching him.. Charlie kicks up, right in Sienna’s stomach and then moves to reach up, grabbing Kassidy’s tights and flipping her out of the ring. He was playing possum all along, Rich. He’s quickly up to his feet and has grabbed Sienna’s hair, slamming her onto the mat hard. He’s mounted Sienna now, smashing closed fist punches to the side of her head.

Rich Russillio: Look, Kassidy Heart is back up and has climbed onto the apron. She springboards herself off of the top rope, flying into the ring and catches Charlie flush with a knee strike!!

James Peters: Daryl’s back up now too. Bleeding from the forehead after having it slammed into the post. He rushes into the ring and hits Kassidy with a step-up enziguri, dropping her for a moment. This has descended into chaos.

Rich Russillio: Sienna is going after Charlie now, hitting a series of HARD kicks to the back of the fallen tag champion. Charlie has to roll out of the ring to get away from them.

James Peters: Daryl and Kassidy are both trading strikes again. Kassidy’s holding her own with her precise strike attacks. Daryl’s backed against the ropes, and Kassidy runs toward him – TAKING HERSELF AND DARYL OVER THE TOP ROPE WITH A HUGE RUNNING CLOTHESLINE!!

Rich Russillio: They land at Charlie Marr’s feet, and Charlie helps his partner up first – before they both grab at Kassidy, hitting her with clubbing blows.

James Peters: But, look!! Sienna Jade has climbed up to the top turnbuckle. STARSTRUCK!!!!!

Rich Russillio: :damn:

James Peters: SIENNA JADE WITH A MOONSAULT, TAKING OUT CHARLIE MARR AND DARYL KINKADE COMPLETELY!!

(“HOLY SHIT! HOLY SHIT! HOLY SHIT!”)

James Peters: That chant is universal, I love it.

Rich Russillio: Even though Kassidy Heart took some of the brunt of that, she’s back to her feet with the help of Sienna. The two have grabbed Charlie and tossed him into the ring. Sienna is back in the ring and tags in Kassidy off of the apron now.

James Peters: Kassidy has a fire in her eye, storming into the ring. It was a good thing Sienna tagged out, even that Moonsault took a lot out of her and she’s still reeling from her previous match.

Rich Russillio: Charlie scratching and clawing his way to his corner, but Daryl isn’t there yet. Kassidy’s grabbed him by the leg, and has pulled him back into the center of the ring. She stomps away on his leg, but he’s managed to use his other to push her off. Turning over quickly and pushing off into his corner – forcing a tag to Daryl who JUST returned to the apron.

James Peters: Daryl grips the middle rope and.. SLINGSHOT THROUGH THE ROPES INTO…

Rich Russillio: “THE NEIMAN MARCUS OF WRESTLING MOVES”!!!!! :damn:

James Peters: HOW THE HELL DID SHE DO THAT?! WHAT EVEN IS THIS!?!?!

Rich Russillio: Kassidy been training in submissions! It’s a double arm leg scissors, James! She caught Daryl as he slingshot himself into the ring, in mid-air, and dragged him down into that submission! She’s just snapped her thighs closed, bending back Daryl’s arms at an awkward angle! Is he going to tap .. well, not literally because he can’t. IS HE GOING TO SUBMIT!?

James Peters: The referee is asking him. DARYL IS SCREAMING IN AGONIZING PAIN….

Rich Russillio: He’s going to… CHARLIE MARR RUSHES INTO THE RING AND ABSOLUTELY DESTROYS KASSIDY WITH A KICK TO THE FACE!!!

James Peters: WHOA! That was aggressive, but it worked. Kassidy’s released the submission, and holds her face in pain. She may have a broken nose, Rich. Or at least a very bloody one.

Rich Russillio: Well, Charlie did say he basically doesn’t give an f-word about these two. That just shows it.

James Peters: But here comes Sienna to Kassidy’s aid, running in and spearing Charlie down to the ground. He’s up to his hands and knees quickly though, then up to his feet – RUNNING KNEE LIFT FROM SIENNA TO CHARLIE AS HE WAS STILL BENT OVER!

Rich Russillio: OUCH! Now Charlie knows how it feels to have his face mangled! And he’s rolled out of the ring to recover from that.

James Peters: Kassidy is up now and is FUMING. She’s officially tagged in Sienna now, and Sienna – who’s still wincing every now and then – stalks over Daryl as he’s moving up to his knees. Hitting the ropes to build some momentum.. Shining Wizard!! Daryl gets hit hard with that move from Sienna, and he drops to the mat.

Rich Russillio: She’s crawling over his body, digging her nails deep into his back and dragging them down. That must sting a little? I don’t really know..

James Peters: Well, whatever – it’s effective, I suppose. Daryl winces some in pain, and fresh trails of blood drops slowly moving down his back.

Rich Russillio: That wasn’t the end of her game plan, though. She’s up and pulls him up, already having his arms wrapped around him.. RIPCCOOORDDDD ELBOOWWW!!

James Peters: Witches Hammer! .. DUCKED!! Sienna looks shocked for a split second after her elbow wizzed over the head of Daryl who had the move scouted. V-TRIGGER! Sienna turns around and catches the Bicycle Knee strike flush to the Jaw! She doesn’t drop completely though, only to her knees.

Rich Russillio: Daryl grabs both of Sienna’s arms… V-TRIGGER AGAIN!! Using the grip on her to keep her steady so he can drive his knee into her face! Daryl has now turned his attention to Kassidy, shouting at her that she’s next.

James Peters: Kassidy doesn’t look phased. She’s shouting back at him, telling him to go fuck himself. Damn.

Rich Russillio: Daryl’s stepped over Sienna, still bickering at Kassidy. But, look. The Women’s champion getting a second, maybe even third wind here. She’s pushed herself up.. Crept behind Daryl…

James Peters: WITCHES HAMMER!!! THIS TIME THAT ELBOW CONNECTS!!

Rich Russillio: Tag to Kassidy! She comes in and immediately the Hearts nod to one another. Sienna moves to the center of the ring and kneels on one knee. OMG SHE’S PROPOSING!

James Peters: Uh.. I don’t think so… THE BEAUTY KILLER!!!!!!!!!!! Kassidy grabbed Daryl’s head, ran him over and smashed it off of Sienna’s knee and covers!!

(One…)

James Peters: SIENNA DIVES THROUGH THE ROPES, CATCHING CHARLIE WITH A SUICIDE DIVE!!

(Two..
Three..!!

DING! DING! DING!)

Bella Braxton: HERE ARE YOUR WINNERS, AND NEWWWWWW EAW UNIFIED TAG TEAM CHAMPIONS … KASSIDY HEART AND SIENNA JADE … THE JADED HEARTS!!!

(“True Love” begins to blast across the public address system. Sienna Jade lets out a scream of delight as the referee inside the ring raises Kassidy Heart’s hand in victory! Sienna runs around to the announcer’s table and grabs the Unified Tag Team Championships.)

Rich Russillio: THE REVOLT QUEENS HAVE DONE IT! THEY HAVE WON THE EAW UNIFIED TAG TEAM CHAMPIONSHIPS!!!!

James Peters: These two women have been through so many ups and downs since coming to Elite Answers Wrestling. Sienna Jade finally fulfilled her destiny tonight and became the face of Empire she was always supposed to be. And together, as a team, the Jaded Hearts have made history. They become the first tag team in EAW to hold both sets of tag belts. It’s only fitting that these two have that accolade attached to their names.

Rich Russillio: There’s no denying that these two are great and now they can check one more thing off their EAW bucket lists.

(Sienna has slipped back inside the ring and has handed Kassidy one of the Unified Tag belts. The two girls wrap their arms around one another and hold one another tight. They’re both whispering to one another, the conversation for their ears only. A year after their first ever conversation, and now they’re here together as the new EAW Unified Tag Team Champions.)

(15 Minute Intermission to get the ring area set up for… BARBED. WIRE. MASSACRE.)

(King of Elite fades back to the ringside area and Voltage ring announcer, Bella Braxton, is standing outside of the ring with a microphone. The ring itself has been transformed into a sadistic looking barbed wire prison. Traditional ring ropes are gone. They have been replaced with yards and yards of barbed wire wrapped around the ring posts. The only way for anyone to get in and out of the ring is by rolling under the bottom layer of barbed wire. Barbed wire covered plywood pieces have been set up in each corner. Various weapons are scattered around the ring area, and of course there are some underneath the ring as well. Absolutely anything goes here tonight.)

(The crowd goes wild knowing that death and destruction are imminent. The fans inside the FNB Stadium ship attempted murder. White lights in the arena begin to flicker, radiating so brilliantly they temporarily blind the audience. The crowd erupts in a chorus of jeers as “Can I Live” by Jay-Z begins to blast throughout the building. A few precious seconds pass before Impact makes his way onto the stage dressed in clothes that are appropriate for a pure fight.)

James Peters: I honestly have no idea what could possibly be going through the head of someone like Impact right now. He’s seen it all and done it all in this business, in this company. This match though? I really don’t know.

Rich Russillio: Well here’s the thing. We both know Impact has the insane ability to absorb pain and keep fighting. It’s going to take an incredible effort from Rex McAllister to put him away here tonight. I know Rex is going to come out game, but this honestly is going to be his biggest challenge to date.

James Peters: #8Reignz

(The former multi-time champion takes a moment to close his eyes, take a few steps down the ramp, and soak in the reaction from the capacity crowd. Finally, Impact opens his cold, blue eyes, heads down the ramp, and makes his way to the ring. Impact surveys his surroundings, taking in each weapon, their location, as well as the ring itself. He’s pretty emotionless. He rolls under the barbed wire and takes his place in the ring.)

(Impact’s music fades and is eventually replaced by “Still Unbroken” by Lynyrd Skynyrd. The roof on FNB Stadium nearly comes off as the World Heavyweight Champion, Rex McAllister, makes his way onto the stage. Rex is also dressed for a fight, wearing street clothes, and his fists are taped. He proudly wears his championship around his waist, but it’s the object he’s carrying in his hands that gets most of the focus. Rex has that singapore cane of his clenched tightly in his right hand.)

Rich Russillio: Here comes the champion and you can tell by the look on his face, he means business. Rex McAllister has been relentlessly mocked by Impact this week and we know our champion. We know that he is going to get inside that ring tonight and leave no stone unturned. He is going to take Impact to task, and beat the snot out of him.

James Peters: The war of words this week were anything but kind. These two men completely despise one another and there’s definitely a lack of respect. Throughout this entire title reign, we have seen Rex constantly rise to the occasion. Tonight won’t be any different.

Rich Russillio: Say what you want about Rex, but he truly is the best pure wrestler in the world. However, as we saw back in December at Road to Redemption Rex is so much more than that. He’s a fighter. Rex has the ability to go to that dark place and get the job done.

(Rex takes a deep breath as he stops in front of the ring. He places his personal weapon in the corner. He ignores Impact and looks out at the crowd. They literally adore him. Rex briefly acknowledges them, unstraps his championship, and rolls into the ring. He steps right up to Impact, holding the championship up, and the referee nervously steps between the two of them. Rex’s music fades out as the two start exchanging words in the middle of the ring.)

Bella Braxton: LADIES AND GENTLEMEN… THE FOLLOWING CONTEST IS YOUR MAIN EVENT OF THE EVENING AND IS SCHEDULED FOR…

Crowd: ONE FALL!!!

Bella Braxton: THIS MATCH IS A BARBED WIRE MASSACRE MATCH FOR THE ELITE ANSWERS WRESTLING WORLD HEAVYWEIGHT CHAMPIONSHIP AND ABSOLUTELY ANYTHING GOES!!!

Crowd: WOEIURWOEKJFLDKJOERTUEORTDGF!

Crowd: WSODKJFKDFGNDCVMNOERUJTEOIRTUOERTE!!

Crowd: SOUERTJELRKJFLGNDKFGOERTUOERTUEGJDFGJFD!!!

Bella Braxton: INTRODUCING FIRST… FROM SEATTLE, WASHINGTON… WEIGHING IN AT 240 POUNDS… IIIMMMMPPPPPAAAAAACCCCCCTTTTTTTT!!!!!!!!

(Impact’s eyes never leave Rex’s as his introduction is made.)

Bella Braxton: AND HIS OPPONENT… HE IS THE REIGNING AND DEFENDING WORLD HEAVYWEIGHT CHAMPION… FROM SEA ISLE, NEW JERSEY… WEIGHING IN AT 238 POUNDS… RRREEEEXXXXX MMMCCCAAALLLLLLIIISSSSTTTTEEEEERRRRRR!!!!!!!!!!!!!!

(Rex’s eyes never leave Impact’s as his introduction is made. The referee takes the championship from Rex, holds it up, and then passes it down to Bella Braxton. He calls for the bell.)

(Ding! Ding! Ding!)

Rich Russillio: Well this match is officially underway and honestly, I don’t even know what to expect James. These two men absolutely despise one another and they’ve been placed in the most barbaric match you can possibly think of. Why Captain Charisma didn’t overturn Veena’s decision… I will never know.

James Peters: It’s probably because deep down, Captain Charisma knows Veena hit the nail on the head with this one. Rex and Impact want to murder one another, and this is the only way they can both do it legally.

Rich Russillio: They’re circling one another right now, and Impact seems content to taunt Rex and sidestep every attempt the World Heavyweight Champion makes to lock up. Rex brought that singapore cane out with him to the the ring, but right now it’s sitting pretty in the corner. There are weapons scattered everywhere though. This match isn’t going to be for the faint at heart.

James Peters: Impact and Rex FINALLY lock up, indulging one another in a traditional collar and elbow tie-up. There’s not much of a physical advantage between either of these two. Rex has like three inches in height on Impact, and Imp has a whole two pounds on Rex. It’s Rex who attempts to seize the early advantage and slips behind Impact. He locks his arms around Imp’s waist and looks for the German. But Impact is quickly out of that! He turns around, grabs Rex in a front facelock and brings Rex to the mat. Rex forces himself up to his knees, grabs Impact’s leg and flips him on his back. Impact lets go of the face lock, which allows Rex to go for an extremely quick over, but Impact shoves Rex off of him.

Rich Russillio: Rex grabs Impact in a side headlock, but the EAW megastar gets his legs around Rex and goes for a body scissors. Rex is quick to let go, slip out of that, and looks to go for the arm. Impact avoids the armbar by rolling out of the way and quickly getting back to his feet. Rex follows suit and both men circle one another again.

James Peters: Both men look for a test of strength and lock hands with one another. Impact looks to grab Rex’s other hand, but the World Heavyweight Champion reaches his foot out and drops Impact with a modified drop toe hold. He doesn’t let go of the hand though, and looks to try and transition this into an armbar! Impact catches Rex in the side of the head with a knee, and that forces Rex to let go!

Rich Russillio: Impact scrambles to his knees, wraps Rex in a facelock! Rex doesn’t panic! He gets his arm up and forces it around the back of Impact’s neck! He rolls them over, which gives him the advantage now. Impact fights his way back to his knees, grabs Rex around the waist, and muscles the champ over onto his back! Rex’s shoulders hit the mat, but he quickly kicks out. Impact hits Rex with a few forearm shots to the face, and pulls Rex up by the hair. Impact looks to whip Rex across the ring, but the champ plants his feet! Rex tries to reverse, but this time it’s Impact who plants his feet. Neither man wants to be the first to bleed in this match!

James Peters: Impact pulls Rex towards him, and looks to take him down with a clothesline! Rex ducks it, slips behind Impact, and tries again for a German suplex! Impact blocks the attempt, forces Rex’s hands apart, and he slips behind now. Impact looking for a German suplex of his own! Rex nails him in the side of the face with an elbow! Rex from behind now! Rex with the waistlock!

Rich Russillio: GERMAN SUPLEX!!!!

James Peters: Impact is down!!!

Rich Russillio: Rex goes for a running knee as Impact gets back up but Impact avoids it!!! Rex hits the brakes before he collides with that barbed wire wrapped board!!! Rex whirls around right as Impact gets up and they lock eyes with one another!!

James Peters: This is definitely not a gaze into your eyes because you’re so beautiful type of stare either.

Rich Russillio: There’s no love lost between these two! We keep stressing that point! The words they’re exchanging right seem pretty heated and our referee, Alan Turlington, wisely steps out of the way.

James Peters: We’re really using the refs’ names now?

Rich Russillio: Rex and Impact are nose to nose! Impact mouths off to Rex and Rex is just shaking his head. Impact throws the first punch! It catches Rex right in the jaw! He follows it up with a slap the kisser and he’s just mocking Rex right now.

Impact (Off Mic): You’re a charmin-soft bitch, Rex. Regular Rex. Plain as fuck, wonder bread mother fu-

James Peters: AND THERE GOES REX!!! HE’S HAD ENOUGH!!! HE TACKLES IMPACT TO THE MAT AND IS SLAMMING THE HALL OF FAMER IN THE FACE WITH THOSE RIGHTS AND LEFTS!!! THE QUICK ATTACK CAUGHT IMPACT OFF GUARD BUT IMPACT FINALLY FORCES REX OFF OF HIM!!! IMPACT IS BACK TO HIS FEET BUT REX GREETS HIM WITH A SERIES OF CLUBBING BLOWS TO THE BACK!!! IMPACT DROPS DOWN TO HIS KNEES!!! HE HITS REX IN THE NADS!!! THANK GOODNESS HE’S ALREADY GOT KIDS!!! IMPACT TAKES REX DOWN AND BEGINS TO LAUNCH HIS OWN ASSAULT!!! HE MOUNTS REX AND BEGINS BEATING THE SHIT OUT OF HIM!!!

Rich Russillio: I’m not even shocked that this match has quickly broken down into a pure fight between these two! Rex finally pushes Impact off and stumbles back to his feet! Impact is back up as well! Impact fires off a right and it sends Rex staggering back! Rex regains his balance! Right hand from Rex! Impact with another right! Rex with his own! IMPACT! REX! IMPACT! IMPACT!! Rex almost stumbles into that barbed wire board in the corner!! Impact swings!! Rex blocks it!! Rex with a chop!!! Impact answers with one of his own!!! Rex fires off another!!! Now it’s Impact!!! REX!!! IMPACT!!! REX!!! IMPACT!!! REX!!! REX!!! REX!!!

James Peters: Impact’s back is almost against the barbed wire that is wrapped all around this ring! He gets his forearm up and catches Rex in the mouth! Impact shoves Rex back to put some distance between them, but Rex rushes forward!!! Impact drops down!!! Rex nearly collides with the barbed wire and now Impact has rolled out of the ring!!!

Rich Russillio: Impact is walking around the outside, shaking off the effects of this match so far. Neither man has been able to draw blood yet which is a feat amongst itself given the hellacious conditions they’re competing in tonight. Rex is also taking a moment to gather his bearings.

James Peters: Impact is reaching under the ring now, searching for some kind of weapon I’m sure. He pulls out a barbed wire wrapped kendo stick!!!

Rich Russillio: REX JUST TOOK OFF! REX GOING HIGH RISK!! THE WORLD HEAVYWEIGHT CHAMPION JUST LAUNCHED HIMSELF OVER THE TOP OF THAT BARBED WIRE!!!

James Peters: REX LANDS ON TOP OF IMPACT!! THE KENDO STICK FALLS FROM IMPACT’S HANDS!!! REX IS SLAMMING HIS FIST INTO IMPACT’S FACE!!! IMPACT REVERSES THEIR POSITIONS THOUGH! NOW HE’S PUNCHING REX!!! THEY’RE JUST BARE KNUCKLES FIGHTING!!! IMPACT AND REX!!! GOING BACK AND FORTH!!! RIGHTS AND LEFTS!!! ROLLING AROUND!!! THESE FANS ARE BESIDE THEMSELVES RIGHT NOW!!! THIS IS EXACTLY WHAT THEY WANTED TO SEE HERE TONIGHT BETWEEN THESE TWO ELITISTS!!! NO ONE CAME HERE TONIGHT TO SEE REX VERSUS IMPACT IN A STANDARD SINGLES MATCH!!!

Rich Russillio: REX MUSCLES IMPACT OFF OF HIM AND GETS UP!!! HE GRABS THE CHALLENGER UP BY THE HAIR!!! REX DRAGS IMPACT TOWARDS THE RING STEPS!!! REX SLAMS IMPACT FACE FI-

James Peters: NO! IMPACT GETS HIS FOOT UP!!! HE NAILS REX WITH AN ELBOW AND SENDS HIM DOWN WITH A CLOTHESLINE!!! IMPACT REACHES UNDER THE RING AND PULLS OUT A METAL TRASH CAN LID!!!

Rich Russillio: BANG GOES THAT LID ACROSS REX’S FACE!!!

James Peters: THAT TRASH CAN LID IS BENT IN HALF! IMPACT IS STOMPING AWAY ON REX AND HE SLAMS HIS FOOT RIGHT INTO REX’S RIBCAGE! IMPACT RAISES THE TRASH CAN LID OVER HIS HEAD AND BEGINS SLAMMING IT DOWN ON REX’S MIDSECTION! IMPACT IS RELENTLESS WITH THIS ASSAULT AND THE CHAMPION IS COMPLETELY VULNERABLE RIGHT NOW! IMPACT TOSSES THAT TRASH CAN LID TO THE GROUND AND STALKS OVER TO THAT KENDO STICK HE HAD A FEW MINUTES AGO!!!

Rich Russillio: The one that’s wrapped in barbed wire.

James Peters: Rex is sitting up as Impact makes his way back over to the champ. Impact rears back like a Major League Baseball player and he swings!!!

Rich Russillio: HE MISSES!!!

Jame Peters: REX ROLLED OUT OF THE WAY!!! REX IS DRAGGING HIMSELF BACK UP NOW BUT IMPACT NAILS HIM RIGHT IN THE BACK!!! THOSE BARBS ARE STUCK TO THE BACK OF REX’S SHIRT AND IMPACT RIPS THEM OUT!!! REX DROPS DOWN TO HIS KNEES AND IMPACT SLAMS THAT LOADED KENDO STICK INTO THE BACK OF REX’S HEAD!!!

Rich Russillio: Rex slumps over and Impact is just beating the shit out of Rex! Over and over he slams that kendo stick into Rex’s back. There’s no mercy being shown and Rex’s shirt is now in tatters. Impact throws the kendo stick down and jerks Rex up. He throws Rex into the barricades and rushes towards him!

James Peters: RUNNING KNEE TO THE FACE!!! IMPACT GRABS REX AND RUNS THEM BOTH TOWARDS THE STEEL RING STEPS!!! BULLDOG TO THE STEPS!!! REX LOOKS OUT!!! HE’S ALSO BEEN BUSTED OPEN!!!! IMPACT GRABS REX BY HIS JEANS AND ROLLS HIM INTO THE RING!!! IMPACT SLIPS INSIDE CAREFULLY AND GOES FOR THE FIRST COVER OF THE MATCH!!!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEE-

Rich Russillio: REX GETS HIS SHOULDER UP!!!

James Peters: Impact immediately goes back to work! He mounts Rex and is delivering those stiff right hands to the champion’s face! Impact gets up and jerks Rex up! Our champion lands a punch to Impact’s gut but it barely has any effect on the challenger. Impact looks to whip Rex into the corner, but Rex is able to drop down to a knee! Impact goes to pull him up but Rex is able to pull Impact’s feet out from underneath of him! Impact kicks Rex back, but Rex is digging deep right now. He’s taken the majority of the punishment in this match so far and he knows that Impact is going to be someone who’s able to go the distance. Rex staggers back up to his feet and Impact is back up as well! Rex ducks a clothesline attempt from Impact. Impact whirls around! Rex gets his foot up! It catches Impact in the jaw! Impact staggers back! Impact gets his balance back and looks to rush forward…

Rich Russillio: REX CATCHES HIM WITH A KICK TO THE MIDSECTION! THAT STOPS IMPACT DEAD IN HIS TRACKS! HE GRABS IMPACT UP INTO A FIREMAN’S CARRY POSITION AND HE DRIVES HIM INTO THE MAT!!!

James Peters: Rex immediately heads to the corner and grabs the singapore cane! He positions it just so and drives the end of it into Impact’s gut over and over! Rex flips the cane and now he’s beating Impact with it! That thing is made of steel and wood, so that shit isn’t going to break! Rex places a final blow right across Impact’s chest and tosses it to the ground! He grabs Impact up by the hair and drags him over to the barbed wire ropes! Rex wipes the blood from his face and lifts Impact up! Impact wiggles! He tries to fight out of this! BUT REX DROPS IMPACT ACROSS THE ROPES! IMPACT LANDS RIGHT ACROSS THE TOP OF THE BARBED WIRE!!!

Rich Russillio: Rex lets Impact hang there for a moment and grabs the cane again! Over and over he whips Impact across the back! Impact is stuck to those ropes and there’s little he can do. He’s being forced to endure this beating and Rex McAllister has literally snapped! Rex has been pushed and pushed to this point, and I’m not even surprised he’s unleashing everything he has here tonight!

James Peters: Rex leaves Impact hanging and he’s getting out of the ring. Why is Rex out of the ring?

Rich Russillio: Rex is walking over to the other side of the ring and he’s looking for something.

James Peters: REX HAS PULLED OUT A PAIR OF BOLT CUTTERS!

Rich Russillio: Impact has managed to somewhat untangle himself from the barbed wire and is down on the mat now, but Rex is going right for that barbed wire wrapped board in the corner. He’s hacking away at it with the bolt cutters and he’s grabbing a piece of the barbed wire from it! Impact sees what’s going on and forces himself back to a vertical base! He heads towards Rex! Rex whips around! REX CATCHES IMPACT IN THE SIDE OF THE HEAD WITH THE BOLT CUTTERS! IMPACT SLUMPS TO THE MAT! REX TAKES THAT BARBED WIRE HE CUT AND OH MY GOD…

James Peters: REX STRETCHED THAT BARBED WIRE ALL THE WAY OUT AND HE’S PLACED IT INTO IMPACT’S MOUTH! REX PULLS IMPACT INTO A CAMEL CLUTCH AND HE IS USING THE BARBED WIRE TO PULL BACK ON IMPACT’S MOUTH! THAT IS FUCKING SICK!

Rich Russillio: Well… I guess that’s one way to shut up Impact…

James Peters: ALAN TURLINGTON THE REFEREE IS ASKING IMPACT IF HE WANTS TO QUIT, BUT OBVIOUSLY HE DOESN’T! IMPACT IS BLEEDING FROM THE MOUTH NOW, AND REX PULLS BACK EVEN FURTHER! HOW IS IMPACT STANDING THIS?!

Rich Russillio: Just years and years of experience and being one of the absolute best in the world.

James Peters: Rex finally slams Impact’s face into the mat and gets up! He pulls Impact up and levels him with a stiff right hand! That strand of barbed wire is just hanging from Impact’s mouth and Rex is real quick to just rip it out. Yikes.

Rich Russillio: Impact has fallen back against the barbed wire ropes and Rex takes the time to wrap that loose strand of the wire around his fist. He stalks towards Impact and slams his fist into Impact’s face. Impact’s forehead is bleeding now and Rex drives his knuckles into that open wound. This is so unsanitary.

James Peters: IMPACT GETS HIS KNEE UP!

Rich Russillio: Rex stumbles backwards and Impact rips himself free of the barbed wire. He lunges forward and takes Rex down with a clothesline! Both men are down at the moment!

(A few minutes pass.)

James Peters: Both men are sitting up now and both of them are getting back up to their feet. Rex and Impact are both looking at one another. There’s so much to consider in this match and when you put the World Heavyweight Championship on the line it completely elevates it to another level. Impact and Rex are circling one another and Rex is wrapping that barbed wire around his fist. He’s motioning at Impact to bring it and without even hesitating, Impact does just that! They lock up and once again, it’s a fight to gain the advantage. Rex slips around and looks for that German, but Impact reverses! Rex with an elbow to the side of the head, but that causes Impact to drop down! He clips Rex in the knee, and that drops the champ. Impact scoops up Rex and looks to crotch him right across the barbed wire ropes! Rex fights out of that, lands back on his feet, and Impact quickly locks his arms around Rex’s waist! Rex reverses and he lifts up Impact… he goes for the rope crotch drop! Impact fights out and now he’s on his feet and both men circle one another again.

Rich Russillio: Impact’s eyes dart towards that singapore cane, but Rex is quick to kick it out of the way. Impact lunges for Rex and grabs him by the leg! Rex with a clubbing blow to the back, but Impact flips the champ down. Impact looks for a quick figure four, but Rex boots him in the back. Impact keeps himself from hitting those ropes chest fist and Rex comes up from behind. ROLL UP!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEE-

James Peters: Impact kicks out!

Rich Russillio: Impact whips around with a spinning wheel kick, but Rex ducks! Rex goes for an enziguri! Impact sidesteps it! Impact jumps on Rex from behind!!! EVIS-

James Peters: REX THROWS HIMSELF FORWARD!!!

Rich Russillio: REX CATCHES HIMSELF ON THE BARBED WIRE ROPES!!!

James Peters: IMPACT LETS GO AND TAKES A FEW STEPS BACK! REX IS TRYING TO UNTANGLE HIMSELF FROM THE BARBS! IMPACT WITH A DROPKICK TO THE BACK! HE GRABS REX FROM BEHIND AND PULLS HIM OUT OF THE BARBS! IMPACT SCOOPS UP REX AND PLACES HIM ACROSS HIS SHOULDERS!!!!

Rich Russillio: DEATH VALLEY DRIVER!!! IMPACT JUST SENT REX THROUGH ONE OF THE BARBED WIRE WRAPPED BOARDS WITH A DEATH VALLEY DRIVER!!! IMPACT THROWS HIMSELF OVER TOP OF REX AND THE CARNAGE AND GOES FOR THE COVER!!!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEEEEEEEEEEEEE!!!!!!

James Peters: REX GOT HIS SHOULDER UP! REX GOT HIS SHOULDER UP!!

Rich Russillio: Frustration crosses Impact’s face! He slowly rises back to his feet and drags Rex McAllister out of the wreckage! Impact grabs Rex by the legs and I think he’s about to go for Walls of Impact!!!

James Peters: BUT REX USES HIS LAST BIT OF STRENGTH AND KICKS IMPACT BACK! IMPACT IS OFF BALANCE AND REX KICKS HIM AGAIN! IMPACT FALLS BACK INTO THE BARBED WIRE ROPES!!! REX GETS UP AS IMPACT UNTANGLES HIMSELF AND REX GREETS IMPACT WITH A BOOT TO THE FACE. IMPACT FALLS BACK AND REX DROPS DOWN. HE WRAPS HIS HAND AROUND THE THROAT OF IMPACT AND STARTS CHOKING HIM! REX LETS UP AND GRABS IMPACT BY THE HAIR! HE TAKES IMPACT AND FORCES IMPACT’S FOREHEAD INTO THE BARBED WIRE!

Rich Russillio: REX HOLDS IMPACT IN PLACE AND DRIVES HIS ELBOW INTO THE BACK OF IMPACT’S SKULL! ALL THAT’S DOING IS FURTHER DRIVING THOSE BARBS INTO IMPACT’S FLESH! IMPACT’S FACE IS A CRIMSON MASK RIGHT NOW AND REX JUST LOOKS LIKE A MAN POSSESSED! IMPACT MANAGES TO CATCH REX WITH AN ELBOW TO THE GUT! HE LANDS ANOTHER! REX IS FORCED TO LOOSEN HIS GRIP AND THAT ALLOWS IMPACT TO GET AWAY FROM THE ROPES! IMPACT THROWS HIS FOOT UP AND IT CONNECTS WITH REX’S JAW! REX COMES RIGHT BACK WITH A RIGHT HAND! IMPACT THROWS A LEFT! REX WITH A RIGHT! IMPACT ANSWERS WITH A SLOPPY UPPERCUT! REX WITH THE KNIFE EDGE CHOP! IMPACT THROWS A STIFF KICK TO REX’S THIGH AND THROWS A RIGHT HAND! REX WITH A KICK OF HIS OWN AND A LEFT! NOW THEY’RE BACK TO TRADING BLOWS! REX! IMPACT! REX! IMPACT! THEY’RE GOING FOR BROKE! HOW EITHER OF THEM HAVE THE ENERGY TO DO THIS RIGHT NOW IS BEYOND ME!

James Peters: IMPACT IS LOOKING FOR THE FIST OF FURY! REX GETS HIS FOOT UP! HE CONNECTS WITH IMPACT’S JAW AND HE GRABS THE HALL OF FAMER BEFORE HE FALLS! REX THROWS IMPACT INTO THE CORNER AND IMPACT LANDS AGAINST ANOTHER BARBED WIRE WRAPPED BOARD! REX RUSHES FORWARD!!!!

Rich Russillio: SPEAR! SPEAR! SPEAR!

James Peters: REX SPEARS IMPACT THROUGH THAT BOARD!!!!

Rich Russillio: :damn:!!!

James Peters: :damn:!!!

1…

2…

3…

4…

5…

6…

7…

Rich Russillio: REX IS FINALLY UP! REX DRAGS IMPACT OUT OF THE WRECKAGE! REX GOES FOR A COVER!!!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEEEEEEEEEEEEE!!!!!!

James Peters: NO!!!!! IMPACT KICKED OUT!!! IMPACT KICKED OUT!!!!!

Rich Russillio: REX CAN’T BELIEVE IT! I CAN’T BELIEVE IT!!!

James Peters: Rex takes a minute to let the situation he’s in register and now he’s getting up! He deadlifts Impact up and German suplexes him to the mat! Rex somehow manages to keep his arms locked, roll through, and lift Rex up once again. He hits a second German suplex! Rex is going for a third, and it’s a struggle. Both men have extended a lot of energy here tonight. But Rex does it! He gets Impact up! A THIRD GERMAN SUPLEX!!! Rex holds this one with a bridging pin!!!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEEEEEEEEEEEEE!!!!!!

Rich Russillio: NO!!! IMPACT KICKED OUT AGAIN! IMPACT KICKED OUT AGAIN!!

James Peters: :wow:

Rich Russillio: Rex slams his hand into the mat in frustration. I know how badly he wants this victory. Impact has been a thorn in his side for the last couple of months! Rex gets up and he begins stomping away on Impact! Over and over the champ kicks the challenger! Rex drops back down and begins choking the challenger. Impact does his best to fight back, but Rex isn’t having it! He slams his fist into Impact’s face one last time and there it is!! THE REX LOCK!!! THE REX LOCK!!!!!

James Peters: IMPACT REACHES FOR THE ROPES!!! BUT HE’S NOT CLOSE ENOUGH!!!! IMPACT PLANTS HIS FOREARMS AND TRIES TO DRAG HIMSELF TOWARDS THE EDGE OF THE RING! REX DOES NOT HAVE THAT STF LOCKED IN ALL THE WAY AND IMPACT IS LITERALLY FORCING HIMSELF TO KEEP FIGHTING THROUGH THE PAIN! REX TRIES TO READJUST AND GET THAT MOVE PROPERLY LOCKED IN, BUT IMPACT’S HANDS GRAB THE EDGE OF THE RING AND HE PULLS HIMSELF FORWARD!!! REX LETS GO BEFORE HE COLLIDES WITH THE BARBED WIRE AND IMPACT SPILLS OUT OF THE RING AND ONTO THE GROUND!!!!

Rich Russillio: BOTH MEN ARE EXHAUSTED BUT SOMEHOW IMPACT IS ABLE TO ROLL ONTO THIS STOMACH AND REACH UNDERNEATH THE RING! REX KNOWS HE HAS TO GET IMPACT BACK IN THE RING IN ORDER TO WIN THE MATCH! REX DROPS DOWN AND GOES TO ROLL OUT OF THE RING…

CRACK!!!!

James Peters: IMPACT JUST SLAMMED A BARBED WIRE WRAPPED STEEL CHAIR INTO REX! IMPACT GRABS ONTO THE RING APRON AND HOISTS HIMSELF BACK UP! REX IS HANGING OFF THE APRON AND IMPACT CRACKS THAT STEEL CHAIR ACROSS THE CHAMPION’S BACK! IMPACT PUSHES REX BACK INTO THE RING AND HE GETS IN AFTER HIM! IMPACT IS SLOW TO HIS FEET BUT NOW THAT HE’S UP, HE’S RAISING THAT CHAIR IN THE AIR AGAIN! IMPACT BRINGS IT DOWN ACROSS REX’S BACK AGAIN! AND AGAIN! AND AGAIN! AND AGAIN!!!!!!!

Rich Russillio: IMPACT OPENS THE CHAIR UP AND PLACES IS BY THE ROPES! IMPACT TAKES A DEEP BREATH AND HE FORCES HIMSELF FORWARD! IMPACT JUMPS ON THE CHAIR! FLIGHT SIGHTS!!! HE JUST USED THE CHAIR AS A SPRINGBOARD SO TO SPEAK! IMPACT LANDS ON REX’S BACK, BUT HE GRABS HIS STOMACH! BOTH OF THESE MEN HAVE JUST LAID WASTE TO ONE ANOTHER HERE TONIGHT! IMPACT IS FINALLY BACK TO HIS KNEES AND HE ROLLS REX OVER! IMPACT WITH THE COVER!!!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEEEEEEEEEEEEE!!!!!!

James Peters: NO! OF COURSE NOT! REX GETS HIS SHOULDER UP!!!

Rich Russillio: NOW IT’S IMPACT WHO’S SLAMMING HIS FIST INTO THE MAT IN FRUSTRATION! HE LOOKS AROUND THE RING AND SEES THAT STRAND OF BARBED WIRE REX USED ON HIM EARLIER! IMPACT CRAWLS TOWARDS IT AND WRAPS IT AROUND HIS OWN FIST NOW! IMMEDIATELY, HE GOES BACK TO REX AND BEGINS PUNCHING HIM IN THE FACE! REX EATS THESE BLOWS AND SEVERAL FRESH WOUNDS APPEAR ON THE CHAMPION’S FACE! FRESH BLOOD BEGINS TO SEEP FROM THOSE CUTS AND IMPACT FALLS BACK, EXHAUSTED!! HE TAKES A MINUTE TO RECOVER AND NOW THE HALL OF FAMER IS BACK UP! HE GRABS REX’S SINGAPORE CANE AND GOES BACK OVER TO HIM! IMPACT LOOKS DOWN AT THE WORLD HEAVYWEIGHT CHAMPION WHO HAS JUST SAT BACK UP! REX’S SHEER WILL TO WIN IS WHAT’S MAKING HIM SIT BACK UP RIGHT NOW!

James Peters: IMPACT SCREAMS AT REX, WHICH BRINGS REX’S EYES UP TO IMPACT’S! BOTH OF THEM WEAR IDENTICAL EXPRESSIONS ON THEIR FACES! THEY’RE BOTH TIRED, ANGRY, DETERMINED, AND PROUD. GOD. BOTH OF THESE MEN ARE SO FUCKING PROUD. IMPACT SHAKES HIS HEAD AS REX MCALLISTER BEGINS TO GET BACK TO HIS FEET…

CRACK!!!

Rich Russillio: THERE GOES THE CANE ACROSS REX’S FACE!!!

CRACK!!!

James Peters: THERE GOES THE CANE ACROSS REX’S CHEST!!!

CRACK!!!

Rich Russillio: THERE GOES THE CANE ACROSS THE TOP OF REX’S HEAD!!!

James Peters: IMPACT DROPS DOWN AND GOES FOR THE COVER!!!

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEEEEEEEEEEEEE!!!!!!

Rich Russillio: :lupe:

James Peters: :lupe:

Rich Russillio: REX KICKED OUT! REX KICKED OUT!

James Peters: IMPACT LETS OUT A STRING OF SWEARS SO LOUD THAT I’M SURE THEY COULD BE HEARD ALL THE WAY BACK HOME!!!!

Rich Russillio: IMPACT GRABS THE SINGAPORE CANE AGAIN AND THIS TIME HE PLACES IT ACROSS REX’S THROAT! IMPACT WRAPS HIS LEGS AROUND REX’S WAIST AND HE’S CHOKING HIM! IMPACT IS LOOKING TO CHOKE REX OUT! REX IS KICKING AND THRASHING… FIGHTING WITH ABSOLUTELY EVERYTHING HE HAS INSIDE OF HIM, BUT IMPACT ISN’T LETTING GO! IMPACT CLOSES HIS EYES AND USES EVERY LAST BIT OF STRENGTH HE HAS INSIDE OF HIM TO HOLD THIS CHOKE IN!!!! REX IS STILL FIGHTING. HE IS STILL TRYING. THE WORLD HEAVYWEIGHT CHAMPION WE ALL KNOW, LOVE, AND RESPECT IS ONE OF THE GREATEST ELITISTS THIS COMPANY HAS EVER SEEN!

James Peters: BUT IMPACT IS TOO AND THAT’S WHAT HE’S SHOWING TO EVERYONE RIGHT NOW! EVERY SINGLE PERSON WHO DOUBTED HIM, CRITICIZED HIM, AND WROTE HIM OFF! HE HAS SHOWN EVERYONE TONIGHT THAT HE STILL WANTS THIS. KARLISLE JEREMIAH IS A CHAMPION IN EVERY SINGLE SENSE OF THE WORD!!!!

Rich Russillio: THE REFEREE IS CHECKING ON REX! IMPACT IS SCREAMING THAT REX IS OUT!

James Peters: :lupe:!!!!!!

Rich Russillio: THAT’S IT!

James Peters: HOLY SHIT!!

Rich Russillio: IMPACT HAS CHOKED OUT REX MCALLISTER!!!

James Peters: THE REFEREE IS CALLING FOR THE BELL!!!!

(Ding! Ding! Ding!)

Rich Russillio: HOLY SHIT! IMPACT DID IT! IMPACT DID IT! #8REIGNZ!!!! #8REIGNZ!!!!

(“Can I Live” by Jay-Z begins to blast across the arena as the fans inside FNB Stadium get to their feet. They’re unsure of how to react. One of the most beloved champion’s in the company’s history just lost his championship, but at the same time Impact just added to his already incredible legacy.)

Bella Braxton: LADIES AND GENTLEMEN… HERE IS YOUR WINNER AND NEW WORLD HEAVYWEIGHT CHAMPION… IIIIMMMMMPPPPPPAAAAAAACCCCCCCCTTTTTTTTT!!!!!!!!!!

(The referee hands the World Heavyweight Championship to Impact and for a moment, the tenured Elitist just stares at it. The crowd is clapping now, urging Impact to get up and have his hand raised in victory.)

James Peters: Impact will never win a popularity contest anywhere, but there’s no denying that he is one of, if not the greatest of all time. This sold-out crowd acknowledges that fact, and they respect it, and that’s why they’re showering Impact with their affection right now.

(Impact finally drags himself up to his feet and he allows referee Alan Turlington to raise his hand in victory. Impact raises the World Heavyweight Championship in the air, relishing the moment, and the fact that once again he has gold in his hands.)

Rich Russillio: My God, what a night.

James Peters: We have a new World Heavyweight Champion, ladies and gentlemen. #8Reignz has legitimately become a thing.

Rich Russillio: Congratulations to all the winners tonight! We’ve seen so many title changes; it’s been incredible. The men and women of this company never cease to amaze me.

James Peters: We also crowned a new King of Elite. Congratulations to Malcolm Jones!!!

Rich Russillio: EAW has never been in a better position than it is right now. I’m so thankful to be part of it, and I just want to take a moment to give a shoutout to Rex McAllister. Rex embodies everything the new generation of Elitist should aspire to be. He’s a dedicated, hard-working person who always gives it his all no matter what. There’s no doubt in my mind that he’s going to bounce back from this and find a way to get close to a third world title reign.

James Peters: But for now, it’s Impact who’s on top of the mountain. The landscape of Voltage has just changed drastically. Elite Answers Wrestling has one of their originals back in the forefront. Congratulations to Impact. Ladies and gentlemen… goodnight!

(One last shot of Impact celebrating his incredible victory over Rex McAllister is shown. Impact is exhausted, bloodied, but there’s no mistaking the smirk across his face. For a final time, he raises the championship up and looks right into the camera.)

Impact: Eight. Fucking. Reignz.

(EAW Logo Bu —

James Peters: HANG ON! HANG ON!

Rich Russillio: DON’T CUT THE BROADCAST YET!!

James Peters: NOAH REIGNER HAS JUST RAN THROUGH THE CROWD AND SLIPPED INTO THE RING! OH MY FUCKING GOD! THIS CROWD IS LOSING THEIR COLLECTIVE SHIT!!!!!

Rich Russillio: IMPACT IS TURNING AROUND! THE NOISE OF THE CROWD GOT HIS ATTENTION! NOAH REIGNER IS RIGHT BEHIND HIM! NOAH HAS THAT BRIEFCASE TOO! IMPACT SEES NOAH!!!!! NOAH RUSHES FORWARD! KILL SHOT! KILL SHOT! KILL FUCKING SHOT!

James Peters: NOAH SLAMS THE BRIEFCASE DOWN, SCREAMS AT THE REFEREE, AND OH MY GOD HE’S DOING IT! HE IS CASHING THIS FUCKING THING IN RIGHT NOW!

Rich Russillio: ALAN TURLINGTON IS FROZEN! NOAH GRABS THE MAN BY THE SHIRT AND IS SCREAMING IN HIS FACE! ALAN IS SHAKING BUT OH MY GOD HE SIGNALS FOR THE BELL!!!

James Peters: OH MY GOD…

Bella Braxton: UHHHH LADIES AND GENTLEMEN… NOAH REIGNER IS OFFICIALLY CASHING IN!!!!

(Ding! Ding! Ding!)

Rich Russillio: NOAH DROPS DOWN, GOES FOR THE COVER, AND HOOKS BOTH LEGS! YOU HAVE GOT TO BE KIDDING ME!!!!!!!!! AFTER EVERYTHING IMPACT AND REX PUT ONE ANOTHER THROUGH TONIGHT…

OOONNNNEEEEE!!!!!!

TTTTWWWWWOOOOOO!!!!!!

TTTTTHHHHHHRRRRRRREEEEEEEEEEEEEEE!!!!!!

(Ding! Ding! Ding!)

James Peters: :wow:

Rich Russillio: …

Bella Braxton: WELP… YOUR WINNER AND NEW WORLD HEAVYWEIGHT CHAMPION… NNNNOOOOAAAAHHHHHHHHHHH RRRREEEEIIIIGGGGNNNNNEEEERRRRRRR!!!!!!

(“DON’T STOP” by InnerPartySystem begins to blast through the building. The crowd is honestly stunned and unsure of how to react. They went from hating Impact beating Rex, to showing him the utmost respect for making history, to being shut down completely by Noah Reigner snatching the moment away. Noah stands up, jerks the World Heavyweight Championship out of Alan’s hands, and raises it high in the air. Evelyn Ridley and Cameron Church have come out, and have climbed into the ring to celebrate with Noah.)

James Peters: This crowd has been stunned into silence.

Rich Russillio: I honestly don’t know what to say.

James Peters: Perhaps that was a little bit of karma Impact had coming. He banned the Kill Shot for his match with Noah. He ended up eating it anyway…

Rich Russillio: :wow:

(Noah looks down at Impact and shakes his head. The new champion is oozing arrogance at the moment.)

Noah Reigner: HOUSE. ALWAYS. WINS. So much for your illustrious eighth title reign.

(EAW Logo Buzzes.)

Written by Anna C. Flowers

More Than A Month: Serena Bennett

Most Valuable Elitist #168